Chapter 15: Q. 7 (page 391)
Which subunit of the E. coli polymerase confers specificity to transcription?
a. α
b. β
c. β'
d. σ
Short Answer
Option d is the correct answer.
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 15: Q. 7 (page 391)
Which subunit of the E. coli polymerase confers specificity to transcription?
a. α
b. β
c. β'
d. σ
Option d is the correct answer.
All the tools & learning materials you need for study success - in one app.
Get started for free
The RNA components of ribosomes are synthesized in the ________. a. cytoplasm b. nucleus c. nucleolus d. endoplasmic reticulum
A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect ?
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated?
Transcribe and translate the following DNA sequence (nontemplate strand): 5'-ATGGCCGGTTATTAAGCA-3'
How many nucleotides are in 12 mRNA codons?
a. 12
b. 24
c. 36
d. 48
What do you think about this solution?
We value your feedback to improve our textbook solutions.