Chapter 15: Q. 7 (page 391)
Which subunit of the E. coli polymerase confers specificity to transcription?
a. α
b. β
c. β'
d. σ
Short Answer
Option d is the correct answer.
/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none}
Learning Materials
Features
Discover
Chapter 15: Q. 7 (page 391)
Which subunit of the E. coli polymerase confers specificity to transcription?
a. α
b. β
c. β'
d. σ
Option d is the correct answer.
All the tools & learning materials you need for study success - in one app.
Get started for free
A scientist identifies a pre-mRNA with the following structure.
What is the predicted size of the corresponding mature mRNA in base pairs (bp), excluding the 5’ cap and 3’ polyA tail? a. 220bp b. 295bp c. 140bp d. 435bp.

Figure 15.11 A scientist splices a eukaryotic promoter in front of a bacterial gene and inserts the gene in a bacterial chromosome. Would you expect the bacteria to transcribe the gene?
In your own words, describe the difference between rho dependent and rho-independent termination of transcription in prokaryotes.
Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?
Tetracycline would directly affect:
a. tRNA binding to the ribosome
b. ribosome assembly
c. growth of the protein chain
Chloramphenicol would directly affect
a. tRNA binding to the ribosome
b. ribosome assembly
c. growth of the protein chain
A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated
What do you think about this solution?
We value your feedback to improve our textbook solutions.