/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 4 If one strand of DNA has the seq... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.

Short Answer

Expert verified
The sequence of the complementary strand is TAGCGCATTGTACCTAAGCC.

Step by step solution

01

Understand the DNA polymer structure

Remember that Adenine (A) always pairs with Thymine (T) and Guanine (G) pairs with Cytosine (C). So these are complement pairings: A (Adenine) with T (Thymine) and C (Cytosine) with G (Guanine).
02

Determine the complementary sequence

To find the complementary sequence, just find the complement of each nucleotide. So for the sequence ATCGCGTAACATGGATTCGG, the complement would be TAGCGCATTGTACCTAAGCC.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Understanding DNA Structure
Deoxyribonucleic acid, commonly known as DNA, is the fundamental building block of life, carrying the genetic instructions for the development, function, growth, and reproduction of all known organisms. DNA is composed of two strands that twist together to form a structure known as a double helix. Each strand consists of repeating units called nucleotides, which are made up of three components: a sugar molecule (deoxyribose), a phosphate group, and a nitrogenous base. There are four types of nitrogenous bases in DNA: adenine (A), thymine (T), guanine (G), and cytosine (C).

The backbone of DNA is formed by the sugar and phosphate groups, which connect in a chain through phosphodiester bonds, while the nitrogenous bases protrude from the backbone, forming the rungs of the DNA ladder. The overall structure of DNA is dynamic and can coil and uncoil during processes like DNA replication and protein synthesis. Understanding the DNA structure is crucial, as it provides the context for how the sequences of bases encode genetic information and how this information is accurately copied and passed to the next generation.
Base Pairing Rules
At the heart of DNA structure are the base pairing rules, often referred to as 'Chargaff's rules'. These rules are key to the replication of DNA and the transmission of genetic information. The rules state that in DNA, the nitrogenous bases pair up in a specific manner: adenine (A) always pairs with thymine (T), and guanine (G) pairs with cytosine (C). These pairs are known as complementary bases, and they form the rungs of the DNA ladder through hydrogen bonding.

This complementarity ensures that the two strands of DNA are antiparallel and complementary to each other. During DNA replication, these rules guarantee that each new DNA molecule is an exact copy of the original. It is this specificity of base pairing that helps maintain the integrity of the genetic information being transferred during cell division.
Nucleotide Sequence and Complementarity
The nucleotide sequence of a DNA strand carries vital genetic instructions, and each sequence corresponds to a specific amino acid sequence in a protein. When biologists or students are tasked with finding the complementary strand to a given DNA sequence, like 'ATCGCGTAACATGGATTCGG', they use the base pairing rules to generate the opposite strand. For example, the corresponding complementary sequence is found by replacing each base with its partner, according to the rules mentioned earlier: A with T, T with A, C with G, and G with C.

The complementary sequence to 'ATCGCGTAACATGGATTCGG' would therefore be 'TAGCGCATTGTACCTAAGCC'. This process is not just crucial for understanding homework problems but also forms the basis for how cells copy their DNA prior to division, ensuring that genetic information is faithfully transmitted to the next generation of cells.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.