/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Principles of Biochemistry Chapter 21 - (Page 1) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 1

A bacterial RNA polymerase elongates RNA at a rate of 70 nucleotides per second, and each transcription complex covers 70 bp of DNA. (a) What is the maximum number of RNA molecules that can be produced per minute from a gene of \(6000 \mathrm{bp}\) ? (Assume that initiation is not rate limiting.) (b) What is the maximum number of transcription complexes that can be bound to this gene at one time?

Problem 3

There are a variety of methods that will allow you to introduce an intact eukaryotic gene (e.g., the triose phosphate isomerase gene) into a prokaryotic cell. Would you expect this gene to be properly transcribed by prokaryotic RNA polymerase? What about the converse situation, where an intact prokaryotic gene is introduced into a eukaryotic cell; will it be properly transcribed by a eukaryotic transcription complex?

Problem 4

Assume that, in a rare instance, a typical eukaryotic triose phosphate isomerase gene contains the correct sequences to permit accurate transcription in a prokaryotic cell. Would the resulting RNA be properly translated to yield the intact enzyme?

Problem 5

Describe how the rate of transcription of the lac operon is affected when \(E\). coli cells are grown in the presence of (a) lactose plus glucose, (b) glucose alone, and (c) lactose alone.

Problem 8

Unlike DNA polymerase, RNA polymerase does not have proofreading activity. Explain why the lack of proofreading activity is not detrimental to the cell.

Problem 9

Mature mRNA from eukaryotic cells is often purified from other components in the cell with the use of columns containing oligo (dT) cellulose. These columns contain short segments of single-stranded deoxyribose thymidylate residues, oligo(dT). attached to a cellulose matrix. Explain the rationale for use of these columns to purify mature mRNA from a mixture of components.

Problem 11

A segment of DNA from the middle of an \(E\). coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction. CCGGCTAAGATCTGACTAGC

Problem 13

In general, if we know the genomic DNA sequence of a gene we can reliably predict the nucleotide sequence of the RNA encoded by that gene. Is this statement also true for tRNAs in prokaryotes? What about tRNAs in eukaryotes?

Problem 15

CRP-cAMP represses transcription of the crp gene. Predict the location of the CRP-cAMP binding site relative to the promoter of the crp gene.

Problem 16

Why are mutations within an intron of a protein-coding gene sometimes detrimental?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks