/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 A stretch of double-stranded DNA... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A stretch of double-stranded DNA contains 1000 bp and its base composition is \(58 \%(\mathrm{G}+\mathrm{C})\). How many thymine residues are in this region of DNA?

Short Answer

Expert verified
The number of thymine residues in this region of DNA is 210.

Step by step solution

01

Calculate A+T content

The G+C content represents 58% of the DNA, thus the A+T content, which should be complementary to the G+C content, is \(100\%-58\%=42\%\). This means that 42% of base pairs are either adenine or thymine.
02

Calculate the Number of A+T base pairs

From the previous step, we know that 42% of the 1000 base pairs are either adenine or thymine. We calculate this by multiplying the total number of base pairs (1000) by the percent of A+T content (0.42), which gives 420 base pairs.
03

Calculate the Number of Thymine Residues

Since the A+T base pairs are composed of adenine and thymine in equal proportions, we divide the total A+T content by 2 to find the number of thymine residues. Thus, \(420 / 2 = 210\) thymine residues.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

GC Content
GC Content refers to the proportion of guanine (G) and cytosine (C) bases in a DNA molecule. These two bases are paired together in the DNA double helix through three hydrogen bonds, which makes G-C pairing more stable than A-T pairing.
In DNA analysis, GC Content is an important characteristic because it influences the molecule's thermal stability. Higher GC content means the DNA strand requires more energy to separate.
  • In the given exercise, the GC Content is 58%, meaning 580 out of the 1000 base pairs in the DNA stretch are either guanine or cytosine.
Understanding the GC content helps in figuring out the corresponding AT Content as both contribute to the total 100% of base composition in a DNA sequence.
AT Content
AT Content, the counterpart to GC Content, represents the percentage of adenine (A) and thymine (T) bases within a DNA molecule. Adenine pairs with thymine using two hydrogen bonds.
Since the DNA molecule consists of complementary base pairs, the AT Content together with GC Content makes up the complete DNA composition.
  • For example, the exercise specifies a GC Content of 58%. Therefore, the AT Content is 42% since 100% - 58% = 42%.
  • This percentage means 420 of the 1000 base pairs are either adenine or thymine.
By understanding these concepts, one can easily determine the proportion of each base in a DNA sequence.
Thymine Residues
Thymine residues refer to the specific part of a DNA sequence where thymine (T) is present. As part of the AT pair, thymine always pairs with adenine through two hydrogen bonds.
To determine the number of thymine residues, you consider half of the AT Content since adenine and thymine are equal in amount in the AT pair.
  • In the exercise's 1000 base pairs, 42% are AT pairs, equaling 420 base pairs.
  • Thymine makes up half of those, so you divide by two, resulting in 210 thymine residues.
This calculation can help deduce the DNA structure's composition, aiding in various genetic analyses and applications.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Consider a processive exonuclease that binds exclusively to doublestranded DNA and degrades one strand in the \(5^{\prime} \rightarrow 3^{\prime}\) direction. In a reaction where the substrate is a \(1 \mathrm{~kb}\) fragment of linear DNA, what will be the predominant products after the digestion has gone to completion?

The recognition sites for the restriction endonucleases BglII and BamHI are shown below. Why is it possible to construct recombinant DNA molecules by combining target DNA cut with BglII and a vector cut with BamHI? $$ \begin{array}{cc} \downarrow & \downarrow \\ \text { AGATCT } & \text { GGATCC } \\ \text { BgIII } & \text { BamHI } \end{array} $$

RNase T1 cleaves RNA after \(\mathrm{G}\) residues to leave a \(3^{\prime}\) phosphate group. Predict the cleavage products of this substrate: $$ \text { pppApCpUpCpApUpApGpCpUpApUpGpApGpU } $$

If one strand of DNA has the sequence ATCGCGTAACATGGATTCGG write the sequence of the complementary strand using the standard convention.

The free-living soil nematode \(C\). elegans was the first metazoan to have its entire \(100 \mathrm{Mb}\) genome sequenced. Overall, the worm genome is \(36 \%(\mathrm{G}+\mathrm{C})\) and \(64 \%(\mathrm{~A}+\mathrm{T})\). The restriction endonuclease HindIII recognizes and cuts the hexameric palindromic sequence AAGCTT to generate sticky ends. (a) Approximately how many HindIII sites would you expect to find in the C. elegans genome? (b) If the worm genome was actually \(25 \% \mathrm{G}\) and \(25 \%\) A, approximately how many HindIII sites would you expect to find?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.