/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 6 Nucleotide Chemistry The cells o... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a \(\mathrm{G} \equiv \mathrm{C}\), not \(\mathrm{A}-\mathrm{T}\), base pair. This \(\mathrm{G}-\mathrm{T}\) mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G-T mismatches.

Short Answer

Expert verified
Cells have a specialized G-T mismatch repair to prevent frequent mutations from spontaneous deamination of 5-methylcytosine to thymine.

Step by step solution

01

Understanding G-T Mismatches

A G-T mismatch occurs when guanine (G) pairs with thymine (T) instead of its usual partner, cytosine (C). This can lead to errors in DNA replication if not corrected.
02

Identifying Consequences of G-T Mismatches

If a G-T mismatch is left uncorrected, during replication, the mismatch can result in a transition mutation through mispairing in future generations of DNA, often leading to permanent changes in the genetic code.
03

Explaining Specialized Repair Systems

Cells have a highly specialized repair mechanism for G-T mismatches because of the frequent occurrence of spontaneous deamination of 5-methylcytosine, which changes it to thymine. This is one of the most common single nucleotide changes in DNA.
04

Deciding on Repair Priorities

The likelihood of spontaneous G-T mismatches due to deamination means that repair systems prioritize correcting these errors to prevent mutations from becoming permanent, thus maintaining genetic stability.
05

Choosing G-C over A-T Repair

Repairing a G-T mismatch to a G≡C pair rather than an A-T pair is important because G≡C base pairs have three hydrogen bonds, compared to the two found in A-T pairs, adding more stability to the DNA double helix.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

G-T Mismatch
The G-T mismatch in DNA is an error where guanine (G) is incorrectly paired with thymine (T) instead of its usual partner, cytosine (C). This error can occur naturally during DNA replication or as a result of spontaneous chemical changes in the nucleotides. Such mismatches have significant implications in DNA replication since they can propagate errors through generations of cells.
Without correction, these mismatches can lead to genetic mutations that might affect cellular function or organismal development. Therefore, cellular mechanisms often prioritize the correction of G-T mismatches to maintain the accuracy of genetic information.
Spontaneous Deamination
Spontaneous deamination is a chemical process where an amino group is removed from a cytosine molecule, converting it into uracil, or from 5-methylcytosine, resulting in thymine. This event is notably significant because 5-methylcytosine is a common modified form of cytosine in eukaryotic DNA.
Due to spontaneous deamination, thymine substitution can lead to G-T mismatches. If not corrected, this can result in genomic mutations, which underscores the importance of specialized repair systems in the cell to promptly address such mismatches.
Genetic Stability
Genetic stability refers to the tendency of an organism's genetic code to remain unchanged over time. It is essential for the proper functioning of cells and, consequently, the organism as a whole. Cells protect genetic stability through various DNA repair mechanisms, particularly focused on correcting mismatched base pairs such as G-T mismatches.
By rectifying these errors, the repair systems prevent mutations that can accumulate over successive cell divisions and lead to diseases or dysfunctional proteins. Maintaining genetic stability is crucial for cell viability and hereditary consistency.
Transition Mutation
Transition mutations occur when a purine base is replaced by another purine, or a pyrimidine is replaced by another pyrimidine. In the context of G-T mismatches, if a mismatch is uncorrected, it may lead to a transition mutation by mispairing during DNA replication cycles, resulting in permanent genetic code changes.
This would mean a G-C base pair being incorrectly replaced to match an A-T pair which is not energetically favorable or stable. Thus, effective repair systems are needed to avoid these mutations, preserving the initial genetic sequences.
5-Methylcytosine
5-Methylcytosine is a modified form of cytosine where a methyl group is added to the carbon at the 5th position. It plays important roles in gene expression regulation and epigenetic signaling in eukaryotic organisms.
Its deamination into thymine is a common cause of G-T mismatches, greatly emphasizing the need for targeted repair mechanisms. These repair systems recognize the resulting mismatches and proactively correct them to maintain the integrity and stability of genetic information. Addressing errors from 5-methylcytosine deamination is central to preventing unnecessary genetic transitions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Preserving DNA in Bacterial Endospores Bacterial endospores form when the environment is no longer conducive to active cell metabolism. The soil bacterium Bacillus subtilis, for example, begins the process of sporulation when one or more nutrients are depleted. The end product is a small, metabolically dormant structure that can survive almost indefinitely with no detectable metabolism. Spores have mechanisms to prevent accumulation of potentially lethal mutations in their DNA over periods of dormancy that can exceed 1,000 years. \(B\). subtilis spores are much more resistant than are the organism's growing cells to heat, UV radiation, and oxidizing agents, all of which promote mutations. a. One factor that prevents potential DNA damage in spores is their greatly decreased water content. How would this affect some types of mutations? b. Endospores have a category of proteins called small acid-soluble proteins (SASPs) that bind to their DNA, preventing formation of cyclobutane-type dimers. What causes cyclobutane dimers, and why do bacterial endospores need mechanisms to prevent their formation?

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCG CAATATTTCTCAAAATATTGCGC \(\left(3^{\prime}\right)\). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the doublestranded DNA have the potential to form any alternative structures?

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACT CACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for T) is constructed, will its melting temperature be higher or lower?

Distinction between DNA Structure and RNA Structure Secondary structures called hairpins may form at palindromic sequences in single strands of either RNA or DNA. The fully base-paired portions of hairpins form helices. How do RNA hairpins differ from DNA hairpins?

Genomic Sequencing In large-genome sequencing projects, the initial data usually reveal gaps between contigs where no sequence information has been obtained. To close the gaps, DNA primers complementary to the \(5^{\prime}\)-ending strand at the end of each contig are especially useful. Explain how researchers could use these primers to close the gaps between contigs.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.