/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 5 Distinction between DNA Structur... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Distinction between DNA Structure and RNA Structure Secondary structures called hairpins may form at palindromic sequences in single strands of either RNA or DNA. The fully base-paired portions of hairpins form helices. How do RNA hairpins differ from DNA hairpins?

Short Answer

Expert verified
RNA hairpins involve A-U base pairs and form more compact A-form helices, while DNA hairpins use A-T base pairs and form the broader B-form helices.

Step by step solution

01

Identify the Basic Components of DNA and RNA

DNA and RNA are made up of nucleotides that contain a sugar, a phosphate group, and a nitrogenous base. DNA has deoxyribose sugar while RNA has ribose sugar. DNA uses the bases adenine (A), cytosine (C), guanine (G), and thymine (T), whereas RNA uses adenine (A), cytosine (C), guanine (G), and uracil (U) instead of thymine.
02

Understand the Secondary Structure of Hairpins

Hairpins in both DNA and RNA occur when single-stranded sequences fold back on themselves to form a double helix with unpaired loops. This structure stabilizes the molecule and can affect its function. The palindrome involved is a sequence where the nucleotides can base pair with the opposite strand forming a double helix in the stem part of the hairpin.
03

Base Pairing Differences

In DNA, the hairpins often involve the classic A-T and G-C base pairing. In RNA, because uracil replaces thymine, hairpins form with A-U and G-C base pairing. This difference slightly alters the stability of RNA hairpins compared to DNA due to the different hydrogen bonding properties of A-U and A-T pairs.
04

Analyze Structural Stability

The 2' hydroxyl group present in the ribose sugar of RNA causes it to adopt a C3'-endo conformation, leading to an A-form helix in RNA hairpins, which is more compact. DNA, lacking this hydroxyl group, prefers a B-form helix, causing DNA hairpins to be slightly wider and less compact.
05

Functional Implications

RNA hairpins often play crucial roles in cellular processes such as RNA splicing, translation regulation, and protein interactions due to their additional functional groups that can form hydrogen bonds. DNA hairpins, while they can occur, have less known functional roles, primarily affecting DNA replication and repair when they occur.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA hairpins
RNA hairpins are fascinating structures that occur when a single strand of RNA folds back upon itself. This folding creates a double helix-like structure with a loop at the end, resembling a hairpin. The stem of the RNA hairpin is typically stabilized by base pairs, much like the double helix of DNA.
What makes RNA hairpins particularly interesting is their role in various cellular processes:
  • They are crucial in mRNA splicing, where they help remove introns and join exons to form mature mRNA ready for translation.
  • RNA hairpins can regulate translation by either promoting or hindering the binding of ribosomes and other translation machinery.
  • They also participate in protein interactions, influencing the function and stability of proteins.
The structural aspect of RNA hairpins is influenced by the presence of uracil instead of thymine, allowing the formation of A-U base pairs which contribute to the overall stability and flexibility of the hairpin structure.
DNA hairpins
DNA hairpins function similarly to their RNA counterparts but have some distinctive features. A DNA hairpin forms when a single-stranded DNA sequence bends back on itself, forming a stem-and-loop structure. This is often seen at palindromic sequences, which are critical for the formation of these hairpins.
Key features of DNA hairpins include:
  • The use of A-T and G-C base pairs in the stem, which affects the stability and dynamics of the hairpin.
  • The B-form helix characteristic of DNA makes these hairpins slightly larger and less compact than RNA hairpins, influencing their functional impact.
  • DNA hairpins are often linked to biological processes such as DNA replication and repair. They can signal enzyme recruitment and act as templates for replication.
While less is known about their functions compared to RNA hairpins, DNA hairpins still play a significant role in maintaining the integrity and coding capacity of the genetic material.
Base pairing differences
Base pairing is a fundamental aspect of nucleic acid structure that influences secondary structures like hairpins. In both DNA and RNA, base pairing occurs between nitrogenous bases through hydrogen bonds.
Here's how they differ:
  • In DNA, the base pairs are adenine-thymine (A-T) and guanine-cytosine (G-C). These pairs form double hydrogen bonds for A-T and triple hydrogen bonds for G-C, providing stability to the DNA hairpin structure.
  • When it comes to RNA, uracil replaces thymine, leading to adenine-uracil (A-U) base pairs instead of A-T. This pair forms double hydrogen bonds, similar to A-T, but they have different energy dynamics and stability.
  • The presence of G-C pairs in both DNA and RNA hairpins adds additional stability due to three hydrogen bonds, making them crucial in the stability and formation of the hairpin structure.
These base pairing differences are central to understanding how RNA and DNA hairpins function and interact with other molecules.
Secondary structures
Secondary structures are critical in determining the shape and function of both DNA and RNA. They refer to the specific conformations formed by single-stranded nucleic acids, such as hairpins, loops, and helices.
An important feature of secondary structures is their role in molecular stability and function:
  • Hairpins are common examples of secondary structures, consisting of a stem formed by base pairs and a loop. These structures can influence the stability and functionality of nucleic acids.
  • The secondary structure of RNA, often called the A-form helix, is more compact due to the 2' hydroxyl group, allowing for tighter interactions and functional versatility.
  • DNA, typically forming a B-form helix, results in a slightly larger and looser secondary structure, affecting its biological roles.
Understanding these secondary structures is critical for analyzing the biological implications of RNA and DNA, as they govern interactions with proteins and are key to the regulation of many cellular processes.
Functional implications of hairpins
Hairpins are not just structural motifs; they play significant roles in various biological functions. The functional implications of RNA and DNA hairpins are far-reaching and diverse.
Let's explore some of their key roles:
  • RNA hairpins are involved in gene regulation, often acting as switches that turn the expression of specific genes on or off by interacting with regulatory proteins or ribosomes.
  • These structures are critical for the correct splicing of RNA transcripts, ensuring the removal of introns and proper formation of mature mRNA.
  • Hairpins in DNA contribute to maintaining genomic integrity by facilitating DNA repair mechanisms and replication processes.
  • They act as recognition sites for proteins that are involved in the maintenance of the chromosome structure and function.
Thus, hairpins are essential for the dynamic and complex regulation of genetic information and its expression across different cellular environments.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCG CAATATTTCTCAAAATATTGCGC \(\left(3^{\prime}\right)\). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the doublestranded DNA have the potential to form any alternative structures?

Next-Generation Sequencing In reversible terminator sequencing, how would the sequencing process be affected if the \(3^{\prime}\)-end-blocking group of each nucleotide were replaced with the \(3^{\prime}\)-H present in the dideoxynucleotides used in Sanger sequencing?

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

The Structure of DNA Elucidation of the threedimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.rcsb.org). Use the PDB identifiers provided in parts (a) and (b) below to retrieve the structure summary for a double-stranded DNA segment. View the 3D structure using JSmol. The viewer select menu is below the right corner of the image box. Once in JSmol, you will need to use both the display menus on the screen and the scripting controls in the JSmol menu. Access the JSmol menu by clicking on the JSmol logo in the lower right corner of the image screen. Refer to the JSmol help links as needed. a. Access PDB ID 141D, a highly conserved, repeated DNA sequence from the end of the genome of HIV-1 (the virus that causes AIDS). Set the Style to Ball and Stick. Then use the scripting controls to color by element (Color > Atoms > By Scheme > Element

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a \(\mathrm{G} \equiv \mathrm{C}\), not \(\mathrm{A}-\mathrm{T}\), base pair. This \(\mathrm{G}-\mathrm{T}\) mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G-T mismatches.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.