/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 Base Sequence of Complementary D... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCG CAATATTTCTCAAAATATTGCGC \(\left(3^{\prime}\right)\). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the doublestranded DNA have the potential to form any alternative structures?

Short Answer

Expert verified
The complementary strand is \( \left(3^{\prime}\right) \text{CGC GTTATAAAGAGTTTTATAACGCG} \left(5^{\prime}\right)\). It contains palindromic sequences that may form alternative structures.

Step by step solution

01

Understanding DNA Base Pairing

DNA strands pair through specific base pairing: guanine (G) pairs with cytosine (C), and adenine (A) pairs with thymine (T). When given a DNA strand, its complementary strand is formed by replacing each base with its pair.
02

Writing the Complementary Sequence

Given the sequence \( \text{GCG CAATATTTCTCAAAATATTGCGC} \), replace each base using the rules of base pairing: G with C, C with G, A with T, and T with A. This gives the complementary sequence \( \left(3^{\prime}\right)\) CGC GTTATAAAGAGTTTTATAACGCG \(\left(5^{\prime}\right)\).
03

Identifying Special Sequence Type

The given and complementary sequences have regions that are palindromic. A palindromic sequence reads the same in one direction on one strand as the opposite direction on the complementary strand. For example, the sequence "GCGC" is palindromic.
04

Evaluating Alternative DNA Structures

Palindromic sequences in DNA can allow for the formation of alternative structures like hairpins, cruciforms, or four-way junctions, which can occur due to the ability of the strands to fold back on themselves.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Complementary DNA Strands
In DNA, the two strands are complementary to each other. This means that each base on one strand pairs with a specific base on the other strand. These pairs are:
  • Guanine (G) pairs with Cytosine (C)
  • Adenine (A) pairs with Thymine (T)
Understanding this pairing allows us to deduce the complementary strand if one strand's sequence is given. For instance, if you have a DNA sequence such as 5'-GCG CAATATTTCTCAAAATATTGCGC-3', you can find the complementary sequence by pairing each base with its partner. Starting from the 3' end, the complementary sequence reads oppositely as 3'-CGC GTTATAAAGAGTTTTATAACGCG-5'. This systematic pairing ensures the uniform width and stability of the DNA helical structure.
Base pairing is crucial for DNA replication, allowing the genetic information to be accurately passed on from one generation to the next.
Palindromic Sequences in DNA
Palindromic sequences are quite fascinating as they read the same forward on one strand as they do backward on the complementary strand. If you think of a palindrome in language, like the word "radar," it's similar in DNA. In the provided DNA sequence, regions like "GCGC" exhibit palindromic characteristics. This mirroring can be important for the cell's biological functions.
In nature, palindromic sequences are often associated with crucial biological processes. They can be recognized by enzymes, which cut DNA, called restriction enzymes. These enzymes use the palindrome-like patterns in DNA to identify specific sites to interact with. Additionally, palindromic sequences can contribute to genetic stability and variability.
Alternative DNA Structures
DNA is not just a rigid double helix, but is quite flexible and can form a variety of alternative shapes under certain conditions. These structures come into play more prominently when there are palindromic sequences. Consider hairpins and cruciforms:
  • Hairpins: Occur when single-stranded DNA loops back on itself, forming a pin-shaped structure.
  • Cruciforms: Occur in double-stranded DNA, creating a cross shape when both strands contain palindromes.
These alternative DNA forms are significant because they can alter how genes are expressed and can play roles in the regulation of genetic processes. For example, they can facilitate certain protein interactions or assist in controlling the activities of genetic regulatory elements. Understanding these structures aids scientists in studying genetic disorders and DNA-based technology development, such as gene editing.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Nucleotide Chemistry The cells of many eukaryotic organisms have highly specialized systems that specifically repair G-T mismatches in DNA. The mismatch is repaired to form a \(\mathrm{G} \equiv \mathrm{C}\), not \(\mathrm{A}-\mathrm{T}\), base pair. This \(\mathrm{G}-\mathrm{T}\) mismatch repair mechanism occurs in addition to a more general system that repairs virtually all mismatches. Suggest why cells might require a specialized system to repair G-T mismatches.

Nucleotide Structure Which positions in the purine ring of a purine nucleotide in DNA have the potential to form hydrogen bonds but are not involved in Watson-Crick base pairing?

The Structure of DNA Elucidation of the threedimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.rcsb.org). Use the PDB identifiers provided in parts (a) and (b) below to retrieve the structure summary for a double-stranded DNA segment. View the 3D structure using JSmol. The viewer select menu is below the right corner of the image box. Once in JSmol, you will need to use both the display menus on the screen and the scripting controls in the JSmol menu. Access the JSmol menu by clicking on the JSmol logo in the lower right corner of the image screen. Refer to the JSmol help links as needed. a. Access PDB ID 141D, a highly conserved, repeated DNA sequence from the end of the genome of HIV-1 (the virus that causes AIDS). Set the Style to Ball and Stick. Then use the scripting controls to color by element (Color > Atoms > By Scheme > Element

Denaturation of Nucleic Acids A duplex DNA oligonucleotide in which one of the strands has the sequence TAATACGACT CACTATAGGG has a melting temperature \(\left(t_{\mathrm{m}}\right)\) of \(59^{\circ} \mathrm{C}\). If an RNA duplex oligonucleotide of identical sequence (substituting U for T) is constructed, will its melting temperature be higher or lower?

Distinction between DNA Structure and RNA Structure Secondary structures called hairpins may form at palindromic sequences in single strands of either RNA or DNA. The fully base-paired portions of hairpins form helices. How do RNA hairpins differ from DNA hairpins?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.