/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 11 Nucleic Acid Structure Explain w... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Nucleic Acid Structure Explain why the absorption of UV light by double- stranded DNA increases (the hyperchromic effect) when the DNA is denatured.

Short Answer

Expert verified
The hyperchromic effect occurs because denaturation increases UV absorption by exposing and unstacking the DNA bases.

Step by step solution

01

Understanding DNA Structure

Double-stranded DNA consists of two nucleotide chains that form a double helix. These strands are held together by hydrogen bonds between complementary bases and hydrophobic interactions between adjacent base pairs.
02

Introduction to UV Absorption

Nucleotides in DNA can absorb UV light. The absorption peak is usually around 260 nm. In intact double-stranded DNA, the bases are stacked closely, limiting the exposure of each nucleotide to UV light.
03

Define Denaturation

Denaturation of DNA refers to the process where the double helix unwinds and the two strands separate. This can occur due to increased temperature or changes in pH.
04

Unstacking of Bases

Upon denaturation, the bases become more exposed as the double-stranded structure unwinds into single strands. This unstacking leads to a more favorable electronic environment for absorption.
05

Hyperchromic Effect Explained

Increased exposure and less stacking of the bases due to denaturation enhances the ability of DNA to absorb UV light, leading to the hyperchromic effect, which is the increase in UV absorbance.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Nucleic Acid Structure
Nucleic acids, like DNA, are made up of long chains of nucleotides. Each nucleotide in DNA consists of a sugar, a phosphate group, and a nitrogenous base. There are four types of nitrogenous bases: adenine (A), cytosine (C), guanine (G), and thymine (T). These bases form specific pairs, where adenine pairs with thymine, and cytosine pairs with guanine. This pairing is due to hydrogen bonding. The specific pairing is what gives DNA its double-stranded nature.
The strands of DNA coil around each other to form a double helix, a structure that is both stable and compact. This helical structure is stabilized by both hydrogen bonds between the bases and hydrophobic interactions, which occur between adjacent bases along the same strand.
When these interactions are disrupted, the structure of DNA can change significantly, impacting how it behaves in various scientific and biological contexts.
UV Absorbance
UV absorbance is an essential tool for studying DNA and other nucleic acids. Nucleotides absorb ultraviolet (UV) light mainly at a wavelength of 260 nm. This property can be used to assess the concentration and purity of DNA in a sample.
In double-stranded DNA, the bases are stacked on top of each other, limiting the UV light absorption. Since the bases absorb UV light, their close stacking in the double helix partially shields them from full exposure.
This shielding results in lower UV absorbance when DNA is double-stranded, as compared to single-stranded DNA or denatured DNA. The absorbance increases significantly once the DNA strands separate.
Hyperchromic Effect
The hyperchromic effect occurs when the absorbance of UV light by DNA increases as the DNA transitions from a double-stranded structure to a single-stranded state. This happens during denaturation, when the hydrogen bonds and hydrophobic interactions that hold the double helix together are disrupted.
As a result, the nitrogenous bases become more exposed, leading to an increase in UV light absorbance. The term 'hyperchromic' refers specifically to this increase in absorbance.
This effect is a key indicator of DNA denaturation and can be measured in a laboratory setting to analyze DNA melting and structural changes, providing valuable insights into the stability and composition of nucleic acids.
Double-stranded DNA
Double-stranded DNA is the form that most naturally occurring DNA takes. It's composed of two complementary strands that wind around each other to form a right-handed helix. The bases of one strand pair with the bases of the other strand through hydrogen bonds, creating a stable double-stranded structure.
This structure is crucial for DNA's role in storing and transmitting genetic information. The double helix protects the genetic code within, while still allowing for the essential biological processes of replication and transcription.
Stability is key to its function, and this is maintained through both hydrogen bonds between base pairs and stacking interactions along the helix. When these interactions are disrupted, strands can separate, as seen during denaturation.
DNA Unwinding
DNA unwinding is a process that occurs under certain conditions like increased temperature or altered pH, leading to the denaturation of the DNA double helix. As the DNA unwinds, the two strands separate, exposing the bases.
This separation is critical for many biological processes, such as replication and transcription, where the genetic information needs to be accessed. Upon unwinding, the DNA no longer holds its compact helical structure, making the bases more accessible.
Such increased accessibility contributes to changes in physical properties like increased UV absorbance, due to the unstacking of bases. Understanding DNA unwinding is vital for research involving genetic manipulation or when analyzing the stability of DNA under different environmental conditions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Base Sequence of Complementary DNA Strands One strand of a double-helical DNA has the sequence \(\left(5^{\prime}\right)\) GCG CAATATTTCTCAAAATATTGCGC \(\left(3^{\prime}\right)\). Write the base sequence of the complementary strand. What special type of sequence is contained in this DNA segment? Does the doublestranded DNA have the potential to form any alternative structures?

Sanger Sequencing Logic In the Sanger (dideoxy) method for DNA sequencing, researchers add a small amount of a dideoxynucleoside triphosphate, such as ddCTP, to the sequencing reaction along with a larger amount of the corresponding deoxynucleoside, such as dCTP. What result would researchers observe if they omitted dCTP from the sequencing reaction?

Genomic Sequencing In large-genome sequencing projects, the initial data usually reveal gaps between contigs where no sequence information has been obtained. To close the gaps, DNA primers complementary to the \(5^{\prime}\)-ending strand at the end of each contig are especially useful. Explain how researchers could use these primers to close the gaps between contigs.

The Structure of DNA Elucidation of the threedimensional structure of DNA helped researchers understand how this molecule conveys information that can be faithfully replicated from one generation to the next. To see the secondary structure of double-stranded DNA, go to the Protein Data Bank website (www.rcsb.org). Use the PDB identifiers provided in parts (a) and (b) below to retrieve the structure summary for a double-stranded DNA segment. View the 3D structure using JSmol. The viewer select menu is below the right corner of the image box. Once in JSmol, you will need to use both the display menus on the screen and the scripting controls in the JSmol menu. Access the JSmol menu by clicking on the JSmol logo in the lower right corner of the image screen. Refer to the JSmol help links as needed. a. Access PDB ID 141D, a highly conserved, repeated DNA sequence from the end of the genome of HIV-1 (the virus that causes AIDS). Set the Style to Ball and Stick. Then use the scripting controls to color by element (Color > Atoms > By Scheme > Element

Distinction between DNA Structure and RNA Structure Secondary structures called hairpins may form at palindromic sequences in single strands of either RNA or DNA. The fully base-paired portions of hairpins form helices. How do RNA hairpins differ from DNA hairpins?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.