/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for General Chemistry Chapter 24 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 13

Explain the nature of the genetic code.

Problem 14

Define codon and anticodon. How do they interact?

Problem 15

Show mathematically why there are 64 possible triplet codons.

Problem 16

Outline how the genetic message in a gene is translated to produce a polypeptide. Include the roles of the gene, messenger RNA, ribosomes, and transfer RNA.

Problem 17

An amino acid must contain which of the following functional groups? a. carboxyl and nitro b. methyl and carboxyl c. alcohol and amido d. amino and carboxyl e. ketal and amino

Problem 18

An example of an addition polymer is a. polyester b. nylon-6,6 c. rubber d. Dacron e. glucose

Problem 19

The bonding responsible for linking the two strands that constitute DNA is a. covalent bonding b. ionic bonding c. ion-dipole bonding d. hydrogen bonding e. phosphate linkages

Problem 20

The complementary base of guanine is a thymine b. guanine c. cytosine d. adenine e. uracil

Problem 21

It is your job to manufacture polymers from a series of monomer units. These monomer units are called \(\mathrm{A}, \mathrm{B},\) and \(\mathrm{C}\). In this problem you need to "build" polymers by linking the monomer units. Represent the polymer linkages using dashes. For example, \(-\mathrm{A}-\mathrm{B}-\mathrm{C}-\) represents a polymer unit made from linking monomer units \(\mathrm{A}, \mathrm{B},\) and \(\mathrm{C}\) a. Build two different homopolymers from your monomer units. b. Build a copolymer from A and B. c. Build a copolymer that is about \(33 \% \mathrm{C}\) and \(66 \% \mathrm{~A}\).

Problem 25

What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? CUAUAUCGAGGACAUACGUGA

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks