/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for General Chemistry Chapter 24 - (Page 4) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 42

How many hydrogen bonds link an adenine-thymine base pair? Would there be any difference in strength between adenine-thymine bonding and adenine-uracil bonding? between adenine-thymine and cytosine-guanine bonding? Explain.

Problem 43

If a codon consists of two nucleotides, how many codons would be possible? Would this be a workable code for the purpose of protein synthesis?

Problem 44

If a codon consists of four nucleotides, how many codons would be possible? Would this be workable as an amino-acid code?

Problem 45

Nucleic acids can be denatured by heat, as proteins can. What bonds are broken when a DNA molecule is denatured? Would DNA of greater percentage composition of guanine and cytosine denature more or less readily than DNA of greater percentage composition of adenine and thymine?

Problem 46

Would RNA of a certain percentage composition of guanine and cytosine denature more or less readily than RNA with a lower percent of guanine and cytosine? Why?

Problem 48

Write the amino-acid sequence obtained from leftto-right translation of the messenger RNA sequence AUUGGCGCGAGAUCGAAUGAGCCCAGU

Problem 49

List the codons to which the following anticodons would form base pairs: \(\begin{array}{lllll}\text { Anticodon: } & \text { GAC } & \text { UAC } & \text { AAA } & \text { CAA }\end{array}\) Codon:

Problem 50

List the anticodons to which the following codons would form base pairs: Codon: \(\quad \mathrm{UUG} \quad\) CAC \(\quad \mathrm{ACU} \quad\) GAA Anticodon:

Problem 53

Write the structural formula of the addition polymer made from trans-1,2-dichloroethene:

Problem 59

Draw the zwitterion structure for the amino acid serine.

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks