/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 48 Write the amino-acid sequence ob... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Write the amino-acid sequence obtained from leftto-right translation of the messenger RNA sequence AUUGGCGCGAGAUCGAAUGAGCCCAGU

Short Answer

Expert verified
The amino acid sequence is: I-G-A-R-S-N-E-P-S.

Step by step solution

01

Understand the Task

The given task is to translate a messenger RNA (mRNA) sequence into an amino acid sequence using the genetic code.
02

Divide the mRNA Sequence into Codons

The mRNA sequence is AUUGGCGCGAGAUCGAAUGAGCCCAGU. We divide this sequence into groups of three nucleotides, called codons. This gives us the following codons: AUU, GGC, GCG, AGA, UCG, AAU, GAG, CCC, AGU.
03

Translate Codons to Amino Acids

Using the genetic code, we translate each codon into its corresponding amino acid: - AUU -> Isoleucine (I) - GGC -> Glycine (G) - GCG -> Alanine (A) - AGA -> Arginine (R) - UCG -> Serine (S) - AAU -> Asparagine (N) - GAG -> Glutamic Acid (E) - CCC -> Proline (P) - AGU -> Serine (S)
04

Write the Amino Acid Sequence

The amino acid sequence obtained from the translation is Isoleucine-Glycine-Alanine-Arginine-Serine-Asparagine-Glutamic Acid-Proline-Serine, which is abbreviated as I-G-A-R-S-N-E-P-S.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Genetic Code
The genetic code is like a dictionary for converting the language of nucleic acids into the language of proteins. It tells us how sequences of three nucleotides, known as codons, correspond to specific amino acids. The genetic code is nearly universal and is used by almost all living organisms to translate mRNA into an amino acid sequence.

Each codon is made up of three nucleotides, and there are 64 possible codon combinations since there are four nucleotides (adenine [A], uracil [U for RNA], cytosine [C], and guanine [G]). Despite the many combinations, these codons code for only 20 different amino acids. This feature makes the genetic code redundant because multiple codons can specify the same amino acid.

It's also important that certain codons serve as signals. For instance, `AUG` is the start codon, signaling the beginning of protein synthesis, while `UAA`, `UAG`, and `UGA` act as stop codons, marking the end of translation.
Amino Acid Sequence
An amino acid sequence is the precise order of amino acids in a protein or peptide chain. This sequence determines how a protein will fold into its three-dimensional structure, which in turn defines its function within the cell.

When the mRNA sequence is read by the ribosome during protein synthesis, the sequence of codons is translated into an amino acid sequence. Each codon corresponds to one of the 20 amino acids, and this sequence of amino acids forms the primary structure of a protein.

In the provided exercise, the amino acid sequence derived from the mRNA sequence `AUUGGCGCGAGAUCGAAUGAGCCCAGU` is Isoleucine-Glycine-Alanine-Arginine-Serine-Asparagine-Glutamic Acid-Proline-Serine, abbreviated as I-G-A-R-S-N-E-P-S. This sequence is crucial as it leads to the protein's ability to perform its specific biological functions.
Codons
Codons are the building blocks of the genetic code. They are sequences of three nucleotides found in mRNA that serve as units of genetic information. Each codon corresponds to a specific amino acid or a stop signal in the synthesis of proteins.

Let's break down the process: when a cell needs to make a protein, it transcribes a section of DNA into mRNA. This mRNA is then read in groups of three nucleotides at a time. Each of these groups is a codon that specifies an amino acid in the growing protein chain.
  • For example, the codon `AUU` specifies the amino acid isoleucine.
  • The codon `GGC` specifies glycine.
During the translation process, transfer RNA (tRNA) molecules, each carrying a specific amino acid, recognize and bind to these mRNA codons, contributing to the formation of a protein.

In our example, the mRNA is divided into these codons: AUU, GGC, GCG, AGA, etc., each directing the addition of a specific amino acid.
Protein Synthesis
Protein synthesis is the process through which cells build proteins. This process is vital for cell function and involves two main stages: transcription and translation.

During transcription, the DNA sequence of a gene is copied to form mRNA. Once transcription is complete, the mRNA leaves the nucleus and heads to a ribosome, the site of translation.

In translation, the ribosome reads the sequence of codons in the mRNA and uses them to assemble a chain of amino acids, thereby synthesizing the protein. This process is crucial because proteins are responsible for most cellular functions.
  • The ribosome matches tRNA molecules carrying amino acids with the correct codons on the mRNA strand.
  • The order of amino acids determines the structure and function of the resulting protein.
In the exercise, the mRNA sequence is translated into an amino acid sequence using the genetic code, resulting in the creation of a peptide chain that folds into a functional protein.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.