Chapter 24: Problem 25
What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? CUAUAUCGAGGACAUACGUGA
Short Answer
Expert verified
Leu-Tyr-Arg-Gly-His-Thr
Step by step solution
01
Identify Codons
The first step in translating an mRNA sequence is to divide it into codons, which are sets of three nucleotides. The given mRNA sequence is CUAUAUCGAGGACAUACGUGA. It can be divided into the following codons: CUA, UAU, CGA, GGA, CAU, ACG, and UGA.
02
Consult the Genetic Code
Using the genetic code, match each codon to its corresponding amino acid:
- CUA codes for Leucine (Leu)
- UAU codes for Tyrosine (Tyr)
- CGA codes for Arginine (Arg)
- GGA codes for Glycine (Gly)
- CAU codes for Histidine (His)
- ACG codes for Threonine (Thr)
- UGA is a stop codon, signaling the end of the translation process, so no amino acid is added for this codon.
03
Assemble the Peptide Chain
Combine the amino acids determined in Step 2 in order to form the initial sequence from the given mRNA:
- Leucine (Leu)
- Tyrosine (Tyr)
- Arginine (Arg)
- Glycine (Gly)
- Histidine (His)
- Threonine (Thr)
These amino acids make up the peptide chain before the stop codon halts the translation.
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
Codons
The genetic code is read in triplets known as codons. Each codon consists of three nucleotides, which together correspond to a specific amino acid or a signal in the process of mRNA translation. This triplet reading frame ensures that the genetic code is accurately translated into a protein. For example, the mRNA sequence provided (CUAUAUCGAGGACAUACGUGA) is broken down into individual codons: CUA, UAU, CGA, GGA, CAU, ACG, and UGA.
It's essential to break down the mRNA sequence into these three-letter codons to understand what genetic information is conveyed.
It's essential to break down the mRNA sequence into these three-letter codons to understand what genetic information is conveyed.
- Codons are universal across almost all organisms.
- Each codon specifies either a single amino acid or a stop signal during translation.
- The specificity of codons ensures that proteins are synthesized correctly.
mRNA Translation
mRNA translation is the biological process where the sequence of an mRNA molecule is decoded to produce a specific polypeptide or protein. During translation, ribosomes read the mRNA codons and match them with complementary tRNA molecules carrying amino acids.
The process of translation involves several key steps:
The process of translation involves several key steps:
- Initiation: The small ribosomal subunit binds to the mRNA.
- Elongation: The ribosome travels along the mRNA, catalyzing the addition of amino acids to the growing chain.
- Termination: When a stop codon is reached, the ribosome releases the polypeptide chain.
Amino Acids
Amino acids are the building blocks of proteins, and each amino acid is encoded by one or more codons. In the translation process, these codons in mRNA are translated into specific amino acids.
For example, from the mRNA sequence given:
For example, from the mRNA sequence given:
- Leucine (Leu): Encoded by the codon CUA.
- Tyrosine (Tyr): Encoded by the codon UAU.
- Arginine (Arg): Encoded by the codon CGA.
- Glycine (Gly): Encoded by the codon GGA.
- Histidine (His): Encoded by the codon CAU.
- Threonine (Thr): Encoded by the codon ACG.
Peptide Chain
The peptide chain is a series of amino acids linked together by peptide bonds, forming the primary structure of a protein. After translation, this chain emerges from the ribosome as a nascent protein chain, which will fold into a functional form.
In our example, the peptide chain assembled from the mRNA sequence is:
In our example, the peptide chain assembled from the mRNA sequence is:
- Leucine
- Tyrosine
- Arginine
- Glycine
- Histidine
- Threonine
Stop Codon
The stop codon is a crucial component in the termination of the mRNA translation process. It signals the ribosome to halt the synthesis of the polypeptide chain. There are three stop codons in the genetic code: UAA, UAG, and UGA.
In the mRNA sequence example (CUAUAUCGAGGACAUACGUGA), UGA is the stop codon. Upon encountering UGA, the ribosome halts translation and releases the newly formed peptide chain. The presence of a stop codon ensures that proteins have a defined end point and are synthesized to the correct length.
In the mRNA sequence example (CUAUAUCGAGGACAUACGUGA), UGA is the stop codon. Upon encountering UGA, the ribosome halts translation and releases the newly formed peptide chain. The presence of a stop codon ensures that proteins have a defined end point and are synthesized to the correct length.
- Stop codons do not code for any amino acids.
- They are essential for the functional completion of protein synthesis.
- Without a stop codon, translation could result in malformed proteins.