/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 25 What amino-acid sequence would r... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What amino-acid sequence would result if the following messenger RNA sequence were translated from left to right? CUAUAUCGAGGACAUACGUGA

Short Answer

Expert verified
Leu-Tyr-Arg-Gly-His-Thr

Step by step solution

01

Identify Codons

The first step in translating an mRNA sequence is to divide it into codons, which are sets of three nucleotides. The given mRNA sequence is CUAUAUCGAGGACAUACGUGA. It can be divided into the following codons: CUA, UAU, CGA, GGA, CAU, ACG, and UGA.
02

Consult the Genetic Code

Using the genetic code, match each codon to its corresponding amino acid: - CUA codes for Leucine (Leu) - UAU codes for Tyrosine (Tyr) - CGA codes for Arginine (Arg) - GGA codes for Glycine (Gly) - CAU codes for Histidine (His) - ACG codes for Threonine (Thr) - UGA is a stop codon, signaling the end of the translation process, so no amino acid is added for this codon.
03

Assemble the Peptide Chain

Combine the amino acids determined in Step 2 in order to form the initial sequence from the given mRNA: - Leucine (Leu) - Tyrosine (Tyr) - Arginine (Arg) - Glycine (Gly) - Histidine (His) - Threonine (Thr) These amino acids make up the peptide chain before the stop codon halts the translation.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Codons
The genetic code is read in triplets known as codons. Each codon consists of three nucleotides, which together correspond to a specific amino acid or a signal in the process of mRNA translation. This triplet reading frame ensures that the genetic code is accurately translated into a protein. For example, the mRNA sequence provided (CUAUAUCGAGGACAUACGUGA) is broken down into individual codons: CUA, UAU, CGA, GGA, CAU, ACG, and UGA.

It's essential to break down the mRNA sequence into these three-letter codons to understand what genetic information is conveyed.
  • Codons are universal across almost all organisms.
  • Each codon specifies either a single amino acid or a stop signal during translation.
  • The specificity of codons ensures that proteins are synthesized correctly.
mRNA Translation
mRNA translation is the biological process where the sequence of an mRNA molecule is decoded to produce a specific polypeptide or protein. During translation, ribosomes read the mRNA codons and match them with complementary tRNA molecules carrying amino acids.

The process of translation involves several key steps:
  • Initiation: The small ribosomal subunit binds to the mRNA.
  • Elongation: The ribosome travels along the mRNA, catalyzing the addition of amino acids to the growing chain.
  • Termination: When a stop codon is reached, the ribosome releases the polypeptide chain.
This decoding requires an accurate match of each codon from mRNA with its specific tRNA, ensuring the proper sequence of amino acids.
Amino Acids
Amino acids are the building blocks of proteins, and each amino acid is encoded by one or more codons. In the translation process, these codons in mRNA are translated into specific amino acids.

For example, from the mRNA sequence given:
  • Leucine (Leu): Encoded by the codon CUA.
  • Tyrosine (Tyr): Encoded by the codon UAU.
  • Arginine (Arg): Encoded by the codon CGA.
  • Glycine (Gly): Encoded by the codon GGA.
  • Histidine (His): Encoded by the codon CAU.
  • Threonine (Thr): Encoded by the codon ACG.
Each amino acid has unique properties that determine the structure and function of the resulting protein.
Peptide Chain
The peptide chain is a series of amino acids linked together by peptide bonds, forming the primary structure of a protein. After translation, this chain emerges from the ribosome as a nascent protein chain, which will fold into a functional form.

In our example, the peptide chain assembled from the mRNA sequence is:
  • Leucine
  • Tyrosine
  • Arginine
  • Glycine
  • Histidine
  • Threonine
Amino acids are sequentially added to the peptide chain in the order dictated by the mRNA, determining the sequence and properties of the resultant protein.
Stop Codon
The stop codon is a crucial component in the termination of the mRNA translation process. It signals the ribosome to halt the synthesis of the polypeptide chain. There are three stop codons in the genetic code: UAA, UAG, and UGA.

In the mRNA sequence example (CUAUAUCGAGGACAUACGUGA), UGA is the stop codon. Upon encountering UGA, the ribosome halts translation and releases the newly formed peptide chain. The presence of a stop codon ensures that proteins have a defined end point and are synthesized to the correct length.
  • Stop codons do not code for any amino acids.
  • They are essential for the functional completion of protein synthesis.
  • Without a stop codon, translation could result in malformed proteins.
By terminating the process at the appropriate time, stop codons play a fundamental role in ensuring that the proteins produced are functional and capable of performing their intended roles within the cell.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.