/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Introduction to Genetic Analysis Chapter 14 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 22

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read \(3: \mathrm{CTATCCGGGCGAACTTTTGGCCG}\) Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

Problem 23

Sometimes, cDNAs turn out to be "chimeras"; that is, fusions of DNA copies of two different mRNAs accidentally inserted adjacently to each other in the same clone. You suspect that a cDNA clone from the nematode Caenorhabditis elegans is such a chimera because the sequence of the cDNA insert predicts a protein with two structural domains not normally observed in the same protein. How would you use the availability of the entire genomic sequence to assess if this cDNA clone is a monster or not?

Problem 25

In browsing through the chimpanzee genome, you find that it has three homologs of a particular gene, whereas humans have only two. a. What are two alternative explanations for this observation? b. How could you distinguish between these two possibilities?

Problem 27

You have sequenced the genome of the bacterium Salmonella typhimurium, and you are using BL.AST analysis to identify similarities within the S. typhimurium genome to known proteins. You find a protein that is 100 percent identical in the bacterium Escherichia coli When you compare nucleotide sequences of the S. typhimurium and \(E\) coli genes, you find that their nucleotide sequences are only 87 percent identical. a. Explain this observation. b. What do these observations tell you about the merits of nucleotide- versus protein-similarity searches in identifying related genes?

Problem 28

To inactivate a gene by RNAi, what information do you need? Do you need the map position of the target gene?

Problem 29

What is the purpose of generating a phenocopy?

Problem 30

What is the difference between forward and reverse genetics?

Problem 31

Why might exome sequencing fail to identify a diseasecausing mutation in an affected person?

Problem 32

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H\). sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (htrps//www.ncbi nlm.nih gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

Problem 34

Some exons in the human genome are quite small (less than 75 bp long. Identification of such "microexons" is difficult because these distances are too short to reliably use ORF identification or codon bias to determine if small genomic sequences are truly part of an mRNA and a polypeptide. What techniques of "gene finding" can be used to try to assess if a given region of \(75 \mathrm{bp}\) constitutes an exon?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks