91Ó°ÊÓ

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H\). sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (htrps//www.ncbi nlm.nih gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

Step by step solution

01

Align the Sequence Reads

First, identify overlaps between the sequence reads to try assembling them into a longer contiguous sequence, or contig. Look for common subsequences in the reads that indicate how they can be joined. For instance, Read 3 and Read 1 overlap on "ATGCGATCTGTGAGC", suggesting that Read 3 can be followed by Read 1.

02

Construct the Sequence Contig

Following the alignments found in Step 1, build the sequence contig. Starting with Read 3 (as it seems to be centrally overlapping with others) and continuing to Read 1, the assembled contig can be constructed as follows: Merge Read 3 with overlapping parts of Read 1, then proceed with overlapping parts and sequences from Reads 5, 2, 6, and 4, respectively. The final sequence contig should be: "AACAAAAATGTTGTTATTTTTATTTCAGATGCGATCTGTGAGCCGAGTCTTTA".

03

Determine All Reading Frames

There are three reading frames in the 5' to 3' direction. You have to consider each nucleotide in the codons for all frames. Frame 1: Start translation from the first base. Frame 2: Start translation from the second base. Frame 3: Start translation from the third base. The same rules apply for the reverse complement, but in reverse direction (frames 4, 5, and 6).

04

Translate the Sequence in All Frames

Using a standard genetic code table, translate the contig sequence for each of the six reading frames identified in Step 3. For instance, the amino acids for frame 1 can be translated as follows: from "AAC" = asparagine (N), "AAA" = lysine (K), and so forth, resulting in a sequence of amino acids for each reading frame.

05

Use BLAST to Find Gene Match

Visit the BLASTp page on NCBI's website. Input the protein sequences obtained from translating the reading frames in Step 4 into the BLASTp query box to search for matches against the protein database. Choose the appropriate options for database and organism, and submit the search to see if the reading frames correspond to any known genes.

Unlock Step-by-Step Solutions & Ace Your Exams!

• Full Textbook Solutions

  Get detailed explanations and key concepts

• Unlimited Al creation

  Al flashcards, explanations, exams and more...

• Ads-free access

  To over 500 millions flashcards

• Money-back guarantee

  We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Reading Frames

When analyzing a DNA sequence, understanding reading frames is crucial. In simple terms, a reading frame refers to one of the three possible ways nucleotides in a DNA sequence can be read as codons (groups of three nucleotides) to translate into proteins.
There are three reading frames on a single strand because you can start reading your sequence from the first nucleotide, the second, or the third.
This changes the groupings of the codons, thus potentially changing the resulting protein sequence.

For instance:

• From the sequence "AACAAA...", starting from the 'A', the reading frame reads 'AAC', 'AAA', etc.
• Starting from the 'A' one spot over, it reads 'ACA', 'AAA', and so on.

Remember, the reverse complement strand also has its own set of reading frames, often referred to as frames 4, 5, and 6. Paying attention to these frames is key in translating sequences accurately.

Sequence Alignment

Sequence alignment involves matching several sequence reads to create the longest possible contiguous sequence, known as a contig. This process is similar to assembling a jigsaw puzzle.
You look for overlapping areas between reads to stitch them together into a coherent sequence.

In the exercise, by recognizing overlaps like the sequence "ATGCGATCTGTGAGC" shared by Read 3 and Read 1, you can deduce how reads fit together. This attention to detail allows for the construction of a more complete view of the genome.

Perseverance and precision in recognizing overlaps and aligning sequences are crucial skills when building accurate DNA sequences from the reads.

BLAST Search

After assembling and translating your sequence, the next step is often to figure out which gene or protein is represented.
BLAST (Basic Local Alignment Search Tool) is invaluable here. It compares your protein sequences against a database to find matches and suggest what function your sequence might have.

To do this:

• Visit the BLAST page on the NCBI website.
• Select relevant options, such as the type of BLAST (BLASTp for protein sequences) and choose the appropriate database and organism.
• Input your translated sequences and search for matches.

This step helps in identifying likely genes your contig might belong to by providing potential matches from the available genome database.

Translation of DNA Sequence

Translating a DNA sequence into a protein sequence involves interpreting the genetic code to determine the amino acids in a protein. Each group of three nucleotides, or codons, in the DNA sequence corresponds to a specific amino acid.
Using a genetic code table, you can match codons to their respective amino acids.

Here's how it works:

• Convert codons like 'AAC' to amino acids using the genetic code (e.g., 'AAC' translates to asparagine).
• Repeat this for each codon in the reading frame to build a complete protein sequence.

This translation process must be done for all reading frames, as different frames could result in different amino acid sequences, potentially representing different proteins. Therefore, understanding the nuances of translation is key for accurate biochemical insights.