/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 31 Why might exome sequencing fail ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Why might exome sequencing fail to identify a diseasecausing mutation in an affected person?

Short Answer

Expert verified
Exome sequencing might miss mutations in non-coding regions, structural variations, or be limited by coverage and database knowledge.

Step by step solution

01

Understand Exome Sequencing

Exome sequencing targets only the exonic regions of the genome, which are portions that code for proteins. It focuses on identifying mutations within these protein-coding regions, potentially missing mutations outside of this scope.
02

Consider Non-Coding Mutations

Investigate the possibility that the disease-causing mutation is in a non-coding region of the DNA, such as regulatory elements, introns, or intergenic regions, which is why exome sequencing might miss it.
03

Explore Structural Variations

Recognize that large structural variations or copy number variants might not be detected by exome sequencing, as these require different analytical techniques.
04

Assess Coverage and Quality

Ensure the sequencing had sufficient coverage and quality. Deep sequencing could be necessary to identify low-frequency mutations that might otherwise be missed.
05

Analyze Interpretation Limitations

Take into account the limitations in current knowledge and databases. Some mutations may not yet be recognized as disease-causing due to incomplete scientific understanding or database updates.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Protein-Coding Regions
Protein-coding regions are specific parts of the genome that contain instructions for producing proteins. These regions are called exons and are crucial because proteins perform essential functions in the body, from building cellular structures to facilitating biochemical reactions. Exome sequencing focuses on these areas to detect genetic mutations related to diseases.
The advantage of examining protein-coding regions is that mutations here can directly affect the function of proteins, leading to various diseases. However, because exome sequencing targets only these specific regions, it may miss important information hidden elsewhere in the genome.
Non-Coding Regions
Unlike protein-coding regions, non-coding regions do not directly produce proteins. However, they have crucial roles in the regulation and expression of genes. These regions include introns, regulatory sequences, and intergenic regions.
While exome sequencing skips non-coding regions, these parts of the genome can hold mutations that influence gene activity. For example, regulatory sequences can affect when and where a gene is active, potentially leading to disease if disrupted. Sometimes, disease-causing mutations can reside in these non-coding areas, making them vital in comprehensive genetic studies.
Structural Variations
Structural variations are larger changes in the genome that involve segments of DNA being duplicated, deleted, translocated, or inverted. These variations can result in significant differences in genetic information and are not typically identified through exome sequencing alone.
Examples of structural variations include copy number variants (CNVs), which can contribute to conditions such as autism or developmental disorders. Identifying structural variations often requires additional genomic techniques beyond exome sequencing, such as whole-genome sequencing or specialized assays.
Genomic Coverage
Genomic coverage refers to the extent and quality with which the genome is sequenced. High coverage ensures that each part of the targeted genome is read multiple times, increasing the chances of accurate mutation identification, especially those with low frequency.
Insufficient coverage in exome sequencing might result in missing important mutations, leading to incomplete genetic analysis. Therefore, achieving high genomic coverage is important for reliable exome sequencing results, helping to ensure that even rare or subtle mutations are detected.
Genetic Databases
Genetic databases are repositories of genomic information that can be used to interpret sequencing results. These databases contain data on known genetic variants and their associations with diseases.
Limitations in genetic databases can hinder mutation interpretation. For instance, unknown or newly identified mutations may not be present in current databases, making it challenging to establish their role in disease. As scientific understanding evolves, regular updates to these databases are crucial for accurately determining the implications of genetic findings.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URF). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows: 15 percent are lethal when knocked out. 25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth). 60 percent show no detectable mutant phenotype at all and resemble wild type. Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.

Sometimes, cDNAs turn out to be "chimeras"; that is, fusions of DNA copies of two different mRNAs accidentally inserted adjacently to each other in the same clone. You suspect that a cDNA clone from the nematode Caenorhabditis elegans is such a chimera because the sequence of the cDNA insert predicts a protein with two structural domains not normally observed in the same protein. How would you use the availability of the entire genomic sequence to assess if this cDNA clone is a monster or not?

You have the following sequence reads from a genomic clone of the Homo sapiens genome: Read 1: ATGCGATCTGTGAGCCGAGTCTTTA Read 2: AACAAAAATGTTGTTATTTTTATTTCAGATG Read 3: TTCAGATGCGATCTGTGAGCCGAG Read 4: TGTCTGCCATTCTTAAAAACAAAAATGT Read 5: TGTTATTTTTATTTCAGATGCGA Read 6: AACAAAAATGTTGTTATT a. Use these six sequence reads to create a sequence contig of this part of the \(H\). sapiens genome. b. Translate the sequence contig in all possible reading frames. c. Go to the BLAST page of the National Center for Biotechnology Information, or NCBI (htrps//www.ncbi nlm.nih gov/BLAST/, Appendix B) and see if you can identify the gene of which this sequence is a part by using each of the reading frames as a query for proteinprotein comparison (BLASTp).

In browsing through the chimpanzee genome, you find that it has three homologs of a particular gene, whereas humans have only two. a. What are two alternative explanations for this observation? b. How could you distinguish between these two possibilities?

What is the difference between a contig and a scaffold?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.