/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 22 You have the following sequence ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

You have the following sequence reads from a genomic clone of the Drosophila melanogaster genome: Read 1: TGGCCGTGATGGGCAGTTCCGGTG Read 2: TTCCGGTGCCGGAAAGA Read \(3: \mathrm{CTATCCGGGCGAACTTTTGGCCG}\) Read 4: CGTGATGGGCAGTTCCGGTG Read 5: TTGGCCGTGATGGGCAGTT Read 6: CGAACTTTTGGCCGTGATGGGCAGTTCC Use these six sequence reads to create a sequence contig of this part of the \(D\). melanogaster genome.

Short Answer

Expert verified
CTATCCGGGCGAACTTTTGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA

Step by step solution

01

Identify Overlapping Regions

Inspect each sequence read to find overlapping regions between them. For example, Read 5 (TTGGCCGTGATGGGCAGTT) overlaps with Read 1 (TGGCCGTGATGGGCAGTTCCGGTG) starting from the second character of Read 5. Similarly, search for other overlaps between the given reads.
02

Construct Initial Contig from Overlaps

Using the overlapping regions, begin constructing the contig by aligning the reads. Start by aligning Read 5 and Read 1 based on the identified overlap. This provides an initial sequence: TTGGCCGTGATGGGCAGTTCCGGTG from Reads 1 and 5.
03

Extend the Contig

Continue to extend the contig using other reads. Next, Read 4 (CGTGATGGGCAGTTCCGGTG) overlaps completely with part of the current sequence. Read 6 (CGAACTTTTGGCCGTGATGGGCAGTTCC) overlaps with the start of our sequence, adding CGAACTTTT to the beginning.
04

Finalize the Contig Sequence

Read 3 (CTATCCGGGCGAACTTTTGGCCG) overlaps with Read 6, adding CTATCCGGGC to the start. Align all parts to complete the contig: CTATCCGGGCGAACTTTTGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA.
05

Verify and Assemble Complete Contig

Verify that all reads fit within the assembled sequence. Make sure overlaps are consistent with the order and covering all parts: CTATCCGGGCGAACTTTTGGCCGTGATGGGCAGTTCCGGTGCCGGAAAGA. This complete sequence represents the contig constructed using all given reads.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Sequence Overlap
To understand the concept of sequence overlap in genomic sequencing, imagine how puzzle pieces fit together. Overlapping sequences are like matching puzzle pieces in this context. Each piece has a region that seamlessly connects to another. This overlap is fundamental in genome assembly.

When dealing with short-read sequences from a genome, we look for where these sequences share common parts. For example, if two sequences both contain a segment like "TGGCCGTG," they are likely to overlap at this point. Finding these overlaps allows us to piece together longer sections of DNA.

In genome sequencing, discovering overlaps between reads is the critical first step in assembling larger contigs, which leads to a more comprehensive view of the genome.
Contig Construction
Contig construction is akin to building a larger picture from overlapping puzzle pieces. Once we've identified overlaps between different sequence reads, we can start to construct a continuous sequence known as a "contig."

The initial step involves aligning and joining sequences that have matching ends. For instance, in our exercise, Read 5 ('TTGGCCGTGATGGGCAGTT') overlaps with Read 1, allowing us to merge them into a longer strand. We continue this process by identifying other reads that can extend our already-assembled sequence.

Through it all, the goal is to minimize gaps and errors. Aligning these sequences accurately is crucial, as it ensures that the contig represents the DNA accurately. Successful contig assembly relies on identifying the maximum overlap and correctly ordering the reads to form a contiguous DNA sequence.
Drosophila melanogaster
Drosophila melanogaster, commonly known as the fruit fly, is an important model organism in genetic research. Its genome is relatively small and well-studied, making it ideal for genomic experiments and learning how genome assembly works.

Despite its simplicity, the fruit fly shares many genetic features with humans, which is why it is often used in studies related to development, behavior, and genetics. Its whole genome has been sequenced, providing vital insights into gene function and regulation.

Working with fragments of its DNA, like in the exercise, offers a practical example without the complexity of larger genomes. Such exercises help researchers refine techniques for more complex organisms by practicing on manageable datasets.
Genomic Sequencing
Genomic sequencing is the comprehensive method used to determine the entire DNA sequence of an organism's genome. It is akin to reading a vast library of genetic information, allowing scientists to understand living things at a molecular level.

This process involves fragmenting DNA into smaller pieces, sequencing each piece, and using computational methods to assemble them. The task is daunting due to the sheer length of DNA strands, requiring efficient computational analysis to accurately assemble sequences like in our exercise.

It plays a pivotal role in medicine, agriculture, and biological research. Genomics helps uncover the genetic underpinnings of diseases, improve crop yields, and explore biodiversity. Learning to assemble genome fragments is foundational, providing essential skills for future advancements in science and technology.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What is the difference between a contig and a scaffold?

Some exons in the human genome are quite small (less than 75 bp long. Identification of such "microexons" is difficult because these distances are too short to reliably use ORF identification or codon bias to determine if small genomic sequences are truly part of an mRNA and a polypeptide. What techniques of "gene finding" can be used to try to assess if a given region of \(75 \mathrm{bp}\) constitutes an exon?

The entire genome of the yeast Saccharomyces cerevisiae has been sequenced. This sequencing has led to the identification of all the open reading frames (ORFs, gene-size sequences with appropriate translational initiation and termination signals) in the genome. Some of these ORFs are previously known genes with established functions; however, the remainder are unassigned reading frames (URF). To deduce the possible functions of the URFs, they are being systematically, one at a time, converted into null alleles by in vitro knockout techniques. The results are as follows: 15 percent are lethal when knocked out. 25 percent show some mutant phenotype (altered morphology, altered nutrition, and so forth). 60 percent show no detectable mutant phenotype at all and resemble wild type. Explain the possible molecular-genetic basis of these three mutant categories, inventing examples where possible.

What is the purpose of generating a phenocopy?

A sequenced fragment of DNA in Drasophila was used in a BL.AST search. The best (closest) match was to a kinase gene from Neuraspora. Does this match mean that the Drosophila sequence contains a kinase gene?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.