/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 The insertion of transposable el... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The insertion of transposable elements into genes can alter the normal pattern of expression. In the following situations, describe the possible consequences on gene expression. a. A LINE inserts into an enhancer of a human gene. b. A transposable element contains a binding site for a transcriptional repressor and inserts adjacent to a promoter. c. \(\operatorname{An} A l u\) element inserts into the \(3^{\prime}\) splice (AG) site of an intron. d. \(A D s\) element that was inserted into the exon of a gene excises imperfectly and leaves 3 base pairs behind in the exon. e. Another excision by that same \(D\) s element leaves 2 base pairs behind in the exon. f. \(A D s\) element that was inserted into the middle of an intron excises imperfectly and leaves 5 base pairs behind in the intron.

Short Answer

Expert verified
Gene expression effects range from decreased expression and aberrant splicing to frameshift mutations, depending on insertion location and context.

Step by step solution

01

Analyze LINE Insertion into Enhancer

A LINE (Long Interspersed Nuclear Element) inserted into an enhancer of a human gene could disrupt the gene's normal expression pattern. Enhancers are responsible for increasing transcription rates, so if a LINE disrupts enhancer activity, it might decrease or abolish the gene's expression.
02

Assess Impact of Repressor Site Insertion near Promoter

A transposable element that introduces a binding site for a transcriptional repressor near a promoter can result in decreased expression of the gene. The repressor could bind to the site, blocking transcription initiation or reducing transcription efficiency.
03

Understand Alu Insertion into 3' Splice Site

Insertion of an Alu element into the 3' AG splice site of an intron can interrupt normal splicing, possibly causing exon skipping or inclusion of intronic sequences in the mRNA transcript. This aberrant splicing may affect protein functionality.
04

Examine Effects of Imperfect Excision Leaving 3 Base Pairs

An imperfect excision of a Ds element leaving behind 3 base pairs in the exon likely causes a frameshift mutation. This mutation can result in a premature stop codon downstream, producing a truncated nonfunctional protein or altering the protein's amino acid sequence.
05

Discuss Impact of Imperfect Excision Leaving 2 Base Pairs

Excision of a Ds element leaving 2 base pairs in the exon also induces a frameshift mutation. This disruption alters the reading frame, potentially resulting in a nonfunctional protein.
06

Analyze Consequences of Excision Leaving 5 Base Pairs in Intron

When 5 base pairs are retained in the intron due to imperfect excision, it may disrupt splicing, especially if it influences the recognition of splice sites. However, if splice sites remain intact, the outcome may be negligible. If disrupted, aberrant splicing could alter the final mRNA and protein product.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Gene Expression
The process of gene expression involves converting genetic information from DNA into a functional product, usually a protein. It is a tightly regulated process comprised of several key stages:
  • **Transcription:** DNA is transcribed into mRNA by RNA polymerase.
  • **RNA processing:** This includes capping, polyadenylation, and splicing of the mRNA transcript.
  • **Translation:** mRNA is translated into a protein on a ribosome.
  • **Post-translational modifications:** Proteins may be modified to become fully functional.
Gene expression allows cells to adapt to changing environments and function correctly. Disrupting any of these stages can alter protein levels and activity, potentially causing disease. Transposable elements, such as LINEs or Alu elements, can insert themselves into specific parts of a gene, influencing gene expression by altering enhancers, promoters, or splice sites.
Frameshift Mutation
A frameshift mutation occurs when nucleotides are inserted or deleted from a DNA sequence, and the number of inserted or deleted nucleotides is not a multiple of three. This impacts the gene's reading frame, which dictates the order in which nucleotides are translated into amino acids.
  • **Impact on Protein:** A frameshift mutation usually results in a completely different translation from the original, often ending in a premature stop codon which truncates the protein.
  • **Nonfunctional Proteins:** Such proteins are typically nonfunctional due to radical changes in their amino acid sequence. If these proteins are crucial, this can lead to disorders.
  • **Frameshift and Disease:** Genetic conditions like cystic fibrosis often arise from frameshift mutations.
Transposable elements, when inserting incompletely, can leave remnants that cause frameshift mutations by altering how genetic code is read during translation.
Splicing
Splicing is a vital mechanism in gene expression where introns are removed from the pre-mRNA transcript, and exons are joined together, forming a mature mRNA that codes for a protein. This occurs in the nucleus before the mRNA is exported to the cytoplasm for translation.
  • **Normal Splicing Process:** Splicing requires precise recognition of splice sites at the ends of introns, marked by specific nucleotide sequences like "AG" at the 3' end.
  • **Role of Spliceosomes:** Spliceosomes, consisting of small nuclear RNAs and proteins, facilitate the cutting and joining process.
  • **Aberrant Splicing:** Transposable elements inserting into splice sites, such as the example of an Alu element, can lead to errors in splicing. This might result in exon skipping or the inclusion of intronic sequences in the final mRNA.
Defective splicing may produce abnormal proteins that are either nonfunctional or gain a new, often detrimental function.
Enhancers
Enhancers are regulatory DNA sequences that, when bound by specific proteins, enhance the transcription of related genes, often at great distances from the promoter. They are crucial in defining where, when, and to what extent a gene is expressed.
  • **Features:** Enhancers can be located upstream or downstream of the gene they regulate, and they can act over large genomic distances.
  • **Impact of Alterations:** When an enhancer is disrupted, for instance by the insertion of a LINE or other transposable element, it can severely affect gene expression. The gene may be expressed at lower levels or not at all.
  • **Multi-Enhancer Influence:** Some genes are controlled by multiple enhancers that precisely control complex expression patterns during development.
Understanding how enhancers work and how their function can be perturbed provides insight into complex genetic regulation and the potential implications in diseases, including cancer.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Of all the genes in the human genome, the ones with the most characterized \(A l u\) insertions are those that cause hemophilia, including several insertions in the factor VIII and factor IX genes. Based on this fact, your colleague hypothesizes that the \(A l u\) element prefers to insert into these genes. Do you agree? What other reason can you provide that also explains these data?

Explain how the properties of \(P\) elements in Drosophila make gene-transfer experiments possible in this organism.

Before the integration of a transposon, its transposase makes a staggered cut in the host target DNA. If the staggered cut is at the sites of the arrows below, draw what the sequence of the host DNA will be after the transposon has been inserted. Represent the transposon as a rectangle. AATTTGGCCTAGTACTAATTGGTTGG TTAAACCGGATCATGATTAACCAACC

The yeast genome has class 1 elements \((T y 1, T y 2,\) and so forth) but no class 2 elements. Can you think of a possible reason why DNA elements have not been successful in the yeast genome?

You meet your friend, a scientist, at the gym and she begins telling you about a mouse gene that she is studying in the lab. The product of this gene is an enzyme required to make the fur brown. The gene is called \(F B\) and the enzyme is called FB enzyme. When \(F B\) is mutant and cannot produce the FB enzyme, the fur is white. The scientist tells you that she has isolated the gene from two mice with brown fur and that, surprisingly, she found that the two genes differ by the presence of a 250 -bp SINE (like the human \(A l u\) element) in the \(F B\) gene of one mouse but not in the gene of the other. She does not understand how this difference is possible, especially given that she determined that both mice make the FB enzyme. Can you help her formulate a hypothesis that explains why the mouse can still produce FB enzyme with a transposable element in its \(F B\) gene?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.