/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 14 Nobel prizes are usually awarded... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Nobel prizes are usually awarded many years after the actual discovery. For example, James Watson, Francis Crick, and Maurice Wilkens were awarded the Nobel Prize in Medicine or Physiology in \(1962,\) almost a decade after their discovery of the double-helical structure of DNA. However, Barbara McClintock was awarded the Nobel Prize in \(1983,\) almost four decades after her discovery of transposable elements in maize. Why do you think it took this long?

Short Answer

Expert verified
It took long due to initial skepticism, lack of technological tools, and a challenge to existing beliefs.

Step by step solution

01

Understand the Discovery Context

Recognize the nature of McClintock’s discovery. She discovered transposable elements (jumping genes) in maize, a concept that was groundbreaking at the time and not yet mainstream in genetics.
02

Assess Scientific Comunity's Perception

Consider the scientific community’s initial reception. During McClintock's time, genetics was dominated by ideas that did not easily incorporate her findings. Her discovery challenged existing beliefs, which may have led to skepticism and slow acceptance.
03

Evaluate the Technological and Methodological Advances

Acknowledge the lack of technological tools. At the time of McClintock’s discovery in the 1940s, there was a limited understanding and lack of advanced methods to understand and validate her findings fully.
04

Review Changes in Scientific Perception

Understand the shift in scientific opinion. Over time, as more evidence accumulated and technology advanced, McClintock’s discovery was validated and became a fundamental concept in genetics.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Transposable Elements
Transposable elements, also known as "jumping genes," are segments of DNA that can move around to different positions within the genome of a single cell. This was a groundbreaking concept when Barbara McClintock discovered these elements in maize during the 1940s. Unlike traditional views that saw the genome as a stable structure, McClintock's discovery suggested that it had pieces capable of altering their position, thus changing the activity of nearby genes.

Understanding transposable elements is crucial for several reasons:
  • They play a significant role in genetic variation and evolution by creating genetic diversity.
  • Transposable elements can influence the gene expression and can lead to mutations if they insert themselves into important genes.
  • They are used in genetic research and biotechnology, providing tools for understanding gene function.
McClintock's work paved the way for future studies, proving that genomes are dynamic, which was instrumental for modern genetics.
Genetics
Genetics is the branch of biology that studies genes, genetic variation, and heredity in living organisms. During McClintock's time, the field was in its developmental stages, with many concepts still poorly understood. Her discovery of transposable elements was initially met with skepticism because it challenged the prevailing ideas about genetic stability.

Historically, the study of genetics focused on understanding how traits were inherited according to Mendelian principles, with genes believed to have fixed positions in chromosomes. McClintock's findings, however, introduced the idea that genes could move, interact differently, and lead to unforeseen genetic outcomes. This was an entirely new perspective that required reevaluation of several existing theories.

The impact of such discoveries is far-reaching:
  • Understanding genetic adaptability.
  • Developing new techniques for genetic engineering.
  • Contributing to advancements in medical genetics and personalized medicine.
Today, genetics continues to be a rapidly growing field thanks to such revolutionary ideas.
Scientific Discovery Timelines
The story of Barbara McClintock's Nobel Prize highlights how scientific discoveries can sometimes take years, or even decades, to gain the recognition they deserve. The timeline for acceptance and understanding of a discovery can be influenced by several factors:

  • **Initial Skepticism:** Revolutionary ideas often face initial resistance from the scientific community, especially if they oppose or significantly alter existing paradigms.
  • **Technological Limitations:** When McClintock made her discovery, the technological tools were not advanced enough to fully validate her findings, slowing acceptance.
  • **Accumulative Evidence:** Over time, more evidence gathered by others can support the initial finding, leading to broader acceptance.
Innovations and discoveries often need time to mature, as understanding deepens and the community adapts to new knowledge. McClintock’s eventual recognition in 1983 underscores the importance of persistence in scientific research, as well as the idea that transformative work may not always be immediately appreciated.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Before the integration of a transposon, its transposase makes a staggered cut in the host target DNA. If the staggered cut is at the sites of the arrows below, draw what the sequence of the host DNA will be after the transposon has been inserted. Represent the transposon as a rectangle. AATTTGGCCTAGTACTAATTGGTTGG TTAAACCGGATCATGATTAACCAACC

You meet your friend, a scientist, at the gym and she begins telling you about a mouse gene that she is studying in the lab. The product of this gene is an enzyme required to make the fur brown. The gene is called \(F B\) and the enzyme is called FB enzyme. When \(F B\) is mutant and cannot produce the FB enzyme, the fur is white. The scientist tells you that she has isolated the gene from two mice with brown fur and that, surprisingly, she found that the two genes differ by the presence of a 250 -bp SINE (like the human \(A l u\) element) in the \(F B\) gene of one mouse but not in the gene of the other. She does not understand how this difference is possible, especially given that she determined that both mice make the FB enzyme. Can you help her formulate a hypothesis that explains why the mouse can still produce FB enzyme with a transposable element in its \(F B\) gene?

As you saw in Figure \(15-22,\) the genes of multicellular eukaryotes often contain many transposable elements. Why do most of these elements not affect the expression of the gene?

Based on the mechanism of gene silencing, what features of transposable elements does the RNAi pathway exploit to ensure that the host's own genes are not also silenced?

The yeast genome has class 1 elements \((T y 1, T y 2,\) and so forth) but no class 2 elements. Can you think of a possible reason why DNA elements have not been successful in the yeast genome?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.