/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 Before the integration of a tran... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Before the integration of a transposon, its transposase makes a staggered cut in the host target DNA. If the staggered cut is at the sites of the arrows below, draw what the sequence of the host DNA will be after the transposon has been inserted. Represent the transposon as a rectangle. AATTTGGCCTAGTACTAATTGGTTGG TTAAACCGGATCATGATTAACCAACC

Short Answer

Expert verified
The DNA sequence will have the transposon inserted at the staggered cut site, forming a continuous chain with the host DNA.

Step by step solution

01

Understand the Staggered Cut

Before the transposon is inserted, the transposase enzyme makes a staggered cut in the host DNA sequence. This means that instead of a straight cut, the DNA is cut in a misaligned or offset fashion across the two strands. Imagine the arrows in the DNA sequence indicating where this staggered cut occurs. A staggered cut typically results in overhanging ends on the DNA.
02

Identify the Site for Staggered Cut

Examine the provided DNA sequences: Top strand: AATTTGGCCTAGTACTAATTGGTTGG Bottom strand complements: TTAAACCGGATCATGATTAACCAACC Identify the precise location where the DNA will be staggered by looking for asymmetrical cutting points that leave short single-stranded overhangs on each end that can easily pair with new sequences introduced by the transposon. Let's assume the arrows are between sequence positions resulting in an overlapped end.
03

Insert the Transposon

After the staggered cut, a transposon will be inserted into the DNA sequence at the cut site. Represent the transposon in the sequence as a rectangle. The DNA sequence will have the transposon's sequence inserted directly where the arrows indicated the cut was made. The host DNA will be joined with this new sequence forming a continuous DNA chain, with ends linked via the transposon.
04

Draw the Integrated Sequence

Combine the top and bottom strands with the transposon inserted at the staggered cut. The new sequence will include the transposon in the middle of the DNA sequence, represented as a rectangle. Any overhanging sequences created by the staggered cuts will have been filled to create a contiguous sequence. It appears as follows: Top strand before: AATTTGGCCTAG | --Transposon-- | ACTAATTGGTTGG Bottom strand: TTAAACCGGAT | --Transposon-- | GATTAACCAACC
05

Finalize the Drawing

Draw the resulting sequence, confirming that the transposon is correctly inserted and the ends are appropriately ligated. The resulting DNA sequence maintains the integrity of both the original host sequence and the inserted transposon. Understand that all parts of the sequence are aligned correctly with no gaps or overlaps, except where appropriate by the staggered cut.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Staggered DNA cuts
In molecular biology, staggered DNA cuts are crucial when understanding how transposons integrate into DNA sequences. These cuts aren't straight or aligned directly opposite each other on the two DNA strands. Instead, they are offset—imagine cutting one strand just a little further along than the opposite strand. This offset creates small single-stranded overhangs at each end of the cut. These overhangs are crucial for subsequent steps in the insertion of a transposon, as they allow for more flexible bonding with new sequences.

When looking at DNA sequences, arrows indicating where staggered cuts occur can show regions that might be more prone to housing transposons. Staggered cuts result in 'sticky ends,' which are regions where new sequences, like those from transposons, can easily ligate. This allows the transposon to integrate smoothly, filling in any gaps caused by the staggered nature of the cut. The process ensures that the integration does not disrupt the overall continuity of the DNA strand.
Transposase enzyme
The transposase enzyme is a fascinating and critical player in the world of genetics that facilitates the movement of transposons. Transposons, sometimes considered as 'jumping genes,' can't insert themselves into DNA alone; they need the help of transposase. This enzyme catalyzes the process by making the initial staggered cuts in the DNA at the target sequence.

When the transposase identifies a suitable site in the host DNA, it performs the role of cutting both DNA strands in a staggered manner. After making the cuts, the enzyme assists in attaching the transposon to the newly created overhangs. This helps ease the insertion process. Transposase is not only instrumental in the cutting and initial attachment process, but it also safeguards against unnecessary DNA damage. Ensuring the new sequence is inserted properly without losing any of the sequence integrity requires the precise actions of this enzyme.
DNA sequence insertion
DNA sequence insertion is a detailed dance of precision, particularly when it comes to placing a transposon into a host DNA sequence. After a target DNA is cut in a staggered format, the main job is to insert the new sequence—in this case, the transposon—cleanly into these gaps. The transposon fits neatly where the staggered cut was made, leveraging the sticky overhangs to attach securely.

Once inserted, additional enzymes often synthesize any missing nucleotides to ensure the DNA sequence remains complete and functional. This results in a continuous, uninterrupted strand. The integration results in what seems like a seamless part of the DNA, where the transposon acts like a bridge between the previously unconnected ends. Over time, this can lead to genetic mutations or variations, forming an essential part of the evolutionary mechanism. Thus, DNA sequence insertion can significantly impact gene expression and genetic diversity.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Of all the genes in the human genome, the ones with the most characterized \(A l u\) insertions are those that cause hemophilia, including several insertions in the factor VIII and factor IX genes. Based on this fact, your colleague hypothesizes that the \(A l u\) element prefers to insert into these genes. Do you agree? What other reason can you provide that also explains these data?

Based on the mechanism of gene silencing, what features of transposable elements does the RNAi pathway exploit to ensure that the host's own genes are not also silenced?

In Drosophila, M. Green found a singed allele \((\mathrm{sn})\) with some unusual characteristics. Females homozygous for this X-linked allele have singed bristles, but they have numerous patches of \(s n^{+}(\text {wild-type })\) bristles on their heads, thoraxes, and abdomens. When these flies are mated with \(s n\) males, some females give only singed progeny, but others give both singed and wild-type progeny in variable proportions. Explain these results.

The yeast genome has class 1 elements \((T y 1, T y 2,\) and so forth) but no class 2 elements. Can you think of a possible reason why DNA elements have not been successful in the yeast genome?

You meet your friend, a scientist, at the gym and she begins telling you about a mouse gene that she is studying in the lab. The product of this gene is an enzyme required to make the fur brown. The gene is called \(F B\) and the enzyme is called FB enzyme. When \(F B\) is mutant and cannot produce the FB enzyme, the fur is white. The scientist tells you that she has isolated the gene from two mice with brown fur and that, surprisingly, she found that the two genes differ by the presence of a 250 -bp SINE (like the human \(A l u\) element) in the \(F B\) gene of one mouse but not in the gene of the other. She does not understand how this difference is possible, especially given that she determined that both mice make the FB enzyme. Can you help her formulate a hypothesis that explains why the mouse can still produce FB enzyme with a transposable element in its \(F B\) gene?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.