Chapter 15: Problem 16
Before the integration of a transposon, its transposase makes a staggered cut in the host target DNA. If the staggered cut is at the sites of the arrows below, draw what the sequence of the host DNA will be after the transposon has been inserted. Represent the transposon as a rectangle. AATTTGGCCTAGTACTAATTGGTTGG TTAAACCGGATCATGATTAACCAACC
Short Answer
Step by step solution
Understand the Staggered Cut
Identify the Site for Staggered Cut
Insert the Transposon
Draw the Integrated Sequence
Finalize the Drawing
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
Staggered DNA cuts
When looking at DNA sequences, arrows indicating where staggered cuts occur can show regions that might be more prone to housing transposons. Staggered cuts result in 'sticky ends,' which are regions where new sequences, like those from transposons, can easily ligate. This allows the transposon to integrate smoothly, filling in any gaps caused by the staggered nature of the cut. The process ensures that the integration does not disrupt the overall continuity of the DNA strand.
Transposase enzyme
When the transposase identifies a suitable site in the host DNA, it performs the role of cutting both DNA strands in a staggered manner. After making the cuts, the enzyme assists in attaching the transposon to the newly created overhangs. This helps ease the insertion process. Transposase is not only instrumental in the cutting and initial attachment process, but it also safeguards against unnecessary DNA damage. Ensuring the new sequence is inserted properly without losing any of the sequence integrity requires the precise actions of this enzyme.
DNA sequence insertion
Once inserted, additional enzymes often synthesize any missing nucleotides to ensure the DNA sequence remains complete and functional. This results in a continuous, uninterrupted strand. The integration results in what seems like a seamless part of the DNA, where the transposon acts like a bridge between the previously unconnected ends. Over time, this can lead to genetic mutations or variations, forming an essential part of the evolutionary mechanism. Thus, DNA sequence insertion can significantly impact gene expression and genetic diversity.