/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 12 What is the complementarity rule... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What is the complementarity rule that governs the synthesis of an RNA molecule during transcription? An RNA transcript has the following sequence: 5'-GGCAUGCAUUACGGCAUCACACUAGGGAUC-3' What is the sequence of the template and coding strands of the DNA that encodes this RNA? On which side (5' or \(3^{\prime}\) ) of the template strand is the promoter located?

Short Answer

Expert verified
The template strand of the DNA molecule is 3'- CCGTACGTAATGCCGTAGTGTGATCCCTAG -5' while the coding strand is 5'- GGCAUGCATTACGGCATCACACTAGGGATC -3. The promoter region is located at the 3' end or downstream end of the template strand.

Step by step solution

01

Understand the complementarity rule in RNA transcription

In transcription, a DNA sequence is transcribed into an RNA sequence. The RNA transcript is synthesized based on the template strand of the DNA molecule. The complementarity rule in transcription is as follows: Adenine (A) in DNA corresponds to Uracil (U) in RNA, Guanine (G) pairs with Cytosine (C), Thymine (T) in DNA pairs with Adenine (A) in RNA and Cytosine (C) in DNA pairs with Guanine (G) in RNA.
02

Determine the sequence of the template and coding strands

Let's first look at the RNA transcript sequence: 5' - GGCAUGCAUUACGGCAUCACACUAGGGAUC - 3'. Convert each RNA nucleotide into its DNA complement according to the rule explained in Step 1. The DNA template strand will therefore be 3'- CCGTACGTAATGCCGTAGTGTGATCCCTAG -5'. The coding strand of the DNA will be the reverse complement of the template strand, with Thymines instead of Uracil: 5'- GGCAUGCATTACGGCATCACACTAGGGATC -3'.
03

Identify the location of the promoter region

The promoter region of the DNA is usually found at the 3' end of the template strand, where the RNA synthesis begins. Therefore, the promoter is located at the 3' end of the template strand.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA synthesis
RNA synthesis, also known as transcription, is the process by which a segment of DNA is copied into RNA by the enzyme RNA polymerase. This process is fundamental for the expression of genes, enabling cells to produce proteins and perform critical functions. During transcription, the DNA double helix unwinds to expose the template strand, which will guide the synthesis of an RNA molecule. Once the RNA is synthesized, it serves various roles, including encoding proteins, acting as a messenger, or regulating cellular processes.
RNA synthesis follows a specific directionality, much like DNA replication. It begins at the promoter region and proceeds from the 5' to the 3' direction of the RNA strand being synthesized.
complementarity rule
The complementarity rule is essential in transcription, ensuring the correct pairing of nucleotides between DNA and RNA. This rule dictates how DNA sequences are converted to RNA sequences, allowing accurate information transfer.
  • Adenine (A) in DNA pairs with Uracil (U) in RNA
  • Guanine (G) pairs with Cytosine (C) in both DNA and RNA
  • Thymine (T) in DNA pairs with Adenine (A) in RNA
  • Cytosine (C) pairs with Guanine (G) in both DNA and RNA
By following this rule, the RNA strand synthesized will be a complementary copy of the DNA template strand, but with Uracil (U) replacing Thymine (T). This concept ensures that the genetic information is transcribed accurately into a form that can be translated into proteins by the ribosome.
DNA template strand
The DNA template strand serves as the guiding sequence for RNA synthesis during transcription. This strand is responsible for dictating the order of nucleotides in the RNA transcript according to the complementarity rule. In the DNA molecule, two strands run antiparallel, but only one of these, the template strand, is used for RNA synthesis.
The sequence of the template strand is read in a 3' to 5' direction, which corresponds to the RNA being synthesized in a 5' to 3' direction. This ensures that RNA is a complementary and antiparallel copy of the DNA template strand. At the beginning of the process, RNA polymerase binds to the promoter region and moves along the template strand to synthesize the RNA molecule.
promoter region
The promoter region is a crucial DNA sequence that signals RNA polymerase where to start synthesizing RNA. It is typically located at the 3' end of the DNA template strand and is crucial for the regulation of gene expression.
Within the promoter region are specific sequences known as "motifs" that are recognized by transcription factors and RNA polymerase. These motifs facilitate the binding of RNA polymerase and the initiation of transcription. By being positioned at the start of the gene, the promoter ensures that RNA synthesis begins accurately and efficiently.
The precise location of the promoter region can significantly influence the timing and level of gene expression, making it a key player in cellular function and adaptation.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.