/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 42 In metagenomic studies, a compar... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

In metagenomic studies, a comparison of ribosomal RNA sequences is often used to determine the number of different species present. What are some characteristics of ribosomal sequences that make them useful for determining what species are present?

Short Answer

Expert verified
Ribosomal RNA sequences are useful because they are universally present, highly conserved, have variable regions for species differentiation, allow efficient PCR amplification, and enable microbial community profiling.

Step by step solution

01

Understand Ribosomal RNA

Ribosomal RNA (rRNA) plays a critical role in the protein synthesis process of all living cells. It is a key component of ribosomes, which are the molecular machines that produce proteins. Understanding this function helps us appreciate why rRNA is universally present and highly conserved across different species.
02

Highlight Universality and Conservation

rRNA sequences are found in every living organism and are highly conserved, meaning that they have remained relatively unchanged throughout evolution. This universality and conservation make them ideal for comparing organisms across different species and taxonomic levels.
03

Analyze Sequence Variability

While rRNA has conserved regions, it also contains variable regions that differ between species. These variable regions provide sufficient differences that can help distinguish between closely related species, which is crucial for species identification in metagenomic studies.
04

Consider Amplification Advantage

rRNA gene regions, especially the 16S rRNA in prokaryotes, have regions flanked by conserved sequences allowing them to be easily targeted and amplified by primers using polymerase chain reaction (PCR). This technical advantage facilitates the efficient and accurate sequencing of rRNA for identification purposes.
05

Emphasize Community Profiling

Due to the combination of conserved and variable regions, rRNA sequences provide the ability to profile microbial communities effectively. This helps in assessing the diversity and composition of species present within a sample without the need for culturing.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Ribosomal RNA
Ribosomal RNA, or rRNA, stands as a fundamental component of the cellular machinery known as ribosomes. This RNA molecule is critical to the production of proteins, participating actively in the translation of messenger RNA (mRNA).
Its ubiquitous presence across all living organisms makes it an indispensable tool for molecular biology.
  • rRNA is universally present in all life forms, from bacteria to humans, making it a key marker in phylogenetic studies.
  • Its highly conserved nature aids in establishing evolutionary connections between different species.
This conservation means that the core functions of rRNA have remained relatively unchanged despite the vast diversity of life on Earth.
Species Identification
In metagenomics, identifying the various species present within a sample hinges significantly on analyzing rRNA sequences. Because these sequences maintain certain conserved regions, they allow scientists to pinpoint and categorize species accurately.
  • Conserved regions of rRNA are uniform across species, serving as reference points for identification.
  • Variable regions introduce enough genetic differences to distinguish between different species, even those closely related.
This precise identification process is crucial in understanding the composition and dynamics of complex biological communities.
Sequence Variability
Despite the conserved nature of certain regions, rRNA sequences also harbor variable regions which are important for differentiating species.
Sequence variability refers to the differences in nucleotide sequences within these variable regions.
  • Variable regions provide the genetic diversity needed to distinguish different species in metagenomic studies.
  • These differences are vital for creating phylogenetic trees, which illustrate the evolutionary relationships between species.
Therefore, sequence variability within rRNA offers both a fingerprint and a detailed map of biodiversity at the molecular level.
16S rRNA
The 16S rRNA is a component of the 30S subunit of prokaryotic ribosomes and is often the focal point in bacterial taxonomy and identification efforts. This particular rRNA molecule provides numerous advantages for microbial studies.
Its unique features make it a staple in genetic and evolutionary biology.
  • 16S rRNA contains both conserved and variable regions, allowing for fine-tuned species differentiation.
  • Its conserved regions facilitate the use of primers for targeted amplification and sequencing via PCR.
This combination of features enables efficient, versatile, and robust approaches to microbial identification without needing to culture the organisms.
Community Profiling
Community profiling through rRNA analysis enables scientists to explore and document the diversity within complex microbial communities.
This approach provides a panoramic view of microbial ecosystems.
  • It allows for assessing both the richness (number of species) and evenness (distribution of species) within a sample.
  • This method is culture-independent, meaning it does not require the growth of microbes in a lab setting, thus capturing a more comprehensive picture of the microbial landscape.
Ultimately, community profiling offers insights into ecological interactions, functions, and the overall health of environmental and clinical samples.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What is the relation between genome size and gene number in prokaryotes?

In recent years, honeybee colonies throughout North America have been decimated by colony collapse disorder (CCD), which results in the rapid deaths of worker bees. First noticed by beekeepers in \(2004,\) the disorder has been responsible for the loss of \(50 \%\) to \(90 \%\) of beekeeping operations in the United States. Evidence suggests that CCD is caused by a pathogen. Diana Cox- Foster and her colleagues (D. Cox-Foster et al. \(2007 .\) Science \(318: 283-287\) ) used a metagenomic approach to try to identify the causative agent of CCD by isolating DNA from normal honeybee hives and from hives that had experienced CCD. A number of different bacteria, fungi, and viruses were identified in the metagenomic analysis. The following table gives the percentage of CCD hives and non-CCD hives that tested positive for four potential pathogens identified in the metagenomic analysis. On the basis of these data, which potential pathogen appears most likely to be responsible for CCD? Explain your reasoning. Do these data prove that this pathogen is the cause of CCD? Explain.

What is the difference between a map-based approach to sequencing a whole genome and a whole-genome shotgun approach?

The human genome does not encode substantially more protein domains than do invertebrate genomes, yet it encodes many more proteins. How are more proteins encoded when the number of domains does not differ substantially?

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: \(5?–TAGTTAAAAC–3?\) Fragment 2: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 3: \(5?–CCCTAGTTAAAAC–3?\) Fragment 4: \(5?–ACCGCAATACCCTAGTT–3?\) Fragment 5: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 6: \(5?–ATTTACCGCAAT–3\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.