/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 21 The human genome does not encode... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The human genome does not encode substantially more protein domains than do invertebrate genomes, yet it encodes many more proteins. How are more proteins encoded when the number of domains does not differ substantially?

Short Answer

Expert verified
Alternative splicing and post-translational modifications allow humans to encode more proteins with similar domain numbers.

Step by step solution

01

Understanding the Question

We need to understand how humans can have a larger variety of proteins compared to invertebrates, despite having a similar number of protein domains. This suggests that other mechanisms are at play to increase protein variety.
02

Exploring Alternative Explanations

Consider the possible mechanisms that diversify protein production. One such mechanism is alternative splicing, where different protein variants are produced from the same gene by excluding or including certain segments (exons) during RNA splicing.
03

Alternative Splicing Explained

In alternative splicing, the exons of the pre-mRNA produced by transcription of a gene are joined in different combinations. This means a single gene can encode multiple proteins, differing in their amino acid sequence and function.
04

Other Mechanisms Contributing to Diversity

Besides alternative splicing, mechanisms like post-translational modifications (e.g., phosphorylation, glycosylation) also increase protein diversity by chemically modifying proteins after they are produced, altering their function, stability, or location.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Protein Diversity
Protein diversity refers to the wide variety of proteins that can be produced in an organism. Despite having a similar number of protein domains, humans produce significantly more proteins than invertebrates. This vast array of proteins arises due to biological processes occurring after a gene is transcribed into RNA, such as alternative splicing and post-translational modifications. These processes create proteins with varied functions and structures, even if they originate from the same genetic material. Protein diversity is crucial for adapting to different physiological conditions and environments. By creating multiple proteins with different roles from a limited number of genes, organisms can develop complex structures and functions.
Post-Translational Modifications
Post-translational modifications (PTMs) play a significant role in increasing protein diversity. PTMs are chemical changes to a protein after it has been synthesized in the body. They can significantly impact a protein's function, activity, or localization within the cell. There are several types of PTMs, including:
  • Phosphorylation: Adding a phosphate group, which can alter a protein's activity.
  • Glycosylation: Adding sugar molecules, which can affect a protein's folding and stability.
  • Ubiquitination: Tagging proteins for degradation, impacting protein lifespan and function.
Through PTMs, proteins exhibit various functions and interactions that they would not otherwise possess. This diversity is essential for complex organism physiology, impacting processes such as immune responses, cell signaling, and metabolism.
Genomic Encoding
Genomic encoding is the process by which genetic information stored in DNA is translated into functional proteins. The human genome encodes the instructions for protein synthesis. However, the number of unique protein domains does not need to be vast to produce diverse proteins. Instead, mechanisms like alternative splicing and post-translational modifications expand the variety of proteins beyond what is directly encoded in the genome.
This means that a single gene can encode several different proteins, depending on how it is expressed. Thus, genomic encoding serves as the foundational blueprint from which protein diversity emerges, while processes beyond initial transcription allow for complexity and adaptability.
RNA Splicing
RNA splicing is a crucial step following the transcription of DNA to RNA. This process edits pre-mRNA by removing introns (non-coding regions) and joining exons (coding regions) together to form mature mRNA. One key mechanism that enhances protein diversity through RNA splicing is alternative splicing.
With alternative splicing, a single gene can produce multiple distinct mRNA sequences, leading to different protein products. This is achieved by selectively including or excluding certain exons during the splicing process. Consequently, proteins with varying amino acid sequences and functions can arise from the same gene. RNA splicing and its variants allow organisms to maximize their genetic information, generating a significant range of proteins crucial for different cellular functions and adaptations.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: \(5?–TAGTTAAAAC–3?\) Fragment 2: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 3: \(5?–CCCTAGTTAAAAC–3?\) Fragment 4: \(5?–ACCGCAATACCCTAGTT–3?\) Fragment 5: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 6: \(5?–ATTTACCGCAAT–3\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

In metagenomic studies, a comparison of ribosomal RNA sequences is often used to determine the number of different species present. What are some characteristics of ribosomal sequences that make them useful for determining what species are present?

How does proteomics differ from genomics?

What is a microarray? How can it be used to obtain information about gene function?

In recent years, honeybee colonies throughout North America have been decimated by colony collapse disorder (CCD), which results in the rapid deaths of worker bees. First noticed by beekeepers in \(2004,\) the disorder has been responsible for the loss of \(50 \%\) to \(90 \%\) of beekeeping operations in the United States. Evidence suggests that CCD is caused by a pathogen. Diana Cox- Foster and her colleagues (D. Cox-Foster et al. \(2007 .\) Science \(318: 283-287\) ) used a metagenomic approach to try to identify the causative agent of CCD by isolating DNA from normal honeybee hives and from hives that had experienced CCD. A number of different bacteria, fungi, and viruses were identified in the metagenomic analysis. The following table gives the percentage of CCD hives and non-CCD hives that tested positive for four potential pathogens identified in the metagenomic analysis. On the basis of these data, which potential pathogen appears most likely to be responsible for CCD? Explain your reasoning. Do these data prove that this pathogen is the cause of CCD? Explain.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.