/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 28 A linear piece of DNA was broken... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: \(5?–TAGTTAAAAC–3?\) Fragment 2: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 3: \(5?–CCCTAGTTAAAAC–3?\) Fragment 4: \(5?–ACCGCAATACCCTAGTT–3?\) Fragment 5: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 6: \(5?–ATTTACCGCAAT–3\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

Short Answer

Expert verified
The contig sequence is 5?-ATTTACCGCAATACCCTAGTTAAAAC-3?.

Step by step solution

01

Identify the Longest Sequence

Examine all the fragments to find the longest one. The longest fragment will serve as an initial guide for building the contiguous sequence. Fragment 2 and Fragment 5 are the longest, both having the sequence: \(5?–ACCGCAATACCCTAGTTAAA–3?\). Choose Fragment 2 as the starting point.
02

Match Overlapping Ends

Look for other fragments that can overlap with the end or the beginning of Fragment 2. Fragment 3 (\(5?–CCCTAGTTAAAAC–3?\)) overlaps with Fragment 2 with the sequence \(5?–CCCTAGTTAAA–3?\). This suggests that Fragment 3 extends Fragment 2 on the 3' end.
03

Extend the Sequence

Extend the base sequence, Fragment 2, by appending the non-overlapping portion of Fragment 3. This creates a longer contiguous sequence: \(5?–ACCGCAATACCCTAGTTAAAAC–3?\).
04

Check for Additional Overlaps

Look for other fragments that might overlap with the newly extended sequence. Fragment 6 (\(5?–ATTTACCGCAAT–3?\)) overlaps with the beginning of the current sequence with \(5?–AT–3?\) at the 5' end, possibly suggesting the start.
05

Final Contig Assembly

Combine Fragment 6 with the extended sequence creating the complete contiguous sequence: \(5?–ATTTACCGCAATACCCTAGTTAAAAC–3?\).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Contig Assembly
Contig assembly is a vital process in the field of DNA sequencing. It refers to the creation of contiguous sequences, known as contigs, from smaller DNA fragments. This approach is essential when dealing with complex genomes that cannot be sequenced in one go. By aligning and merging overlapping DNA fragments, scientists construct a continuous segment that reflects the original DNA sequence.

When assembling contigs, several key steps are involved:
  • Identify the longest fragment: This serves as the starting point. It often contains the most information and acts as the backbone for the assembly.
  • Determine overlaps: Overlapping sequences between fragments are crucial. They serve as connectors to piece together separate DNA fragments.
  • Extend sequences by adding non-overlapping portions from other fragments, thereby lengthening the contig.
  • Check for further overlaps: This helps in verifying and completing the contiguous sequence.
Successful contig assembly results in a sequence that closely represents the original DNA, allowing for further analysis and study.
Fragment Overlap
Fragment overlap is the cornerstone of contig assembly. In the context of DNA sequencing, it refers to the shared or identical sequences found at the ends of different DNA fragments. These overlaps act as "puzzle pieces" that fit together to create a longer continuous DNA sequence.

To effectively utilize fragment overlaps:
  • Identify any identical sequences between ends of different fragments. These overlaps indicate where fragments can be joined together.
  • Use overlaps to confirm the correct orientation and positioning of fragments. This is crucial because DNA strands have directionality, with 5' to 3' ends.
  • Combine overlapping fragments to form larger sequences while ensuring there are no mismatches or errors.
Accurate identification of fragment overlaps leads to the successful reconstruction of the original DNA sequence, making it a fundamental step in genomic research.
Genomic Sequence Reconstruction
Genomic sequence reconstruction is the ultimate goal of processes like contig assembly and involves recreating the original sequence of a genome from fragmented pieces. It's akin to completing a jigsaw puzzle where the goal is to visualize the complete picture from scattered pieces.

This reconstruction process involves:
  • Sequencing random fragments of a genome to obtain smaller readable segments.
  • Assembling contigs by aligning overlapping fragments. This reduces the complexity by merging smaller fragments into larger ones.
  • Piecing together the complete sequence from multiple contigs, if necessary, ensuring the entire genome is represented without gaps.
Genomic sequence reconstruction is critical for understanding genetic information. It lays the foundation for further analyses, such as identifying genes, exploring evolutionary relationships, and studying genetic variations. It's a meticulous yet rewarding process, leading to insights into the genetic blueprint of an organism.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Study anywhere. Anytime. Across all devices.