/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 40 A scientist determines the compl... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A scientist determines the complete genomes and proteomes of a liver cell and a muscle cell from the same person. Would you expect bigger differences in the genomes or in the proteomes of these two cell types? Explain your answer.

Short Answer

Expert verified
Bigger differences are expected in the proteomes of liver and muscle cells, as genomes are identical.

Step by step solution

01

Define Genomes and Proteomes

The genome of a cell comprises the entire set of DNA, including all of its genes. Since liver and muscle cells come from the same person, they possess identical genomic sequences. The proteome, on the other hand, is the entire set of proteins expressed by a cell, tissue, or organism at a certain time. The proteomes of liver and muscle cells are different because they perform different functions.
02

Identify Function and Expression Differences

Liver and muscle cells serve distinct functions in the body, leading to differences in which genes are expressed as proteins. Liver cells are involved in metabolism and detoxification, requiring enzymes and proteins specific to these tasks. Muscle cells are responsible for contraction and movement, expressing different sets of proteins such as actin and myosin for this purpose.
03

Compare Genome Consistency vs Proteome Variability

Given that the genome remains constant across cell types, no differences exist between the genomes of liver and muscle cells. In contrast, the proteome is dynamic and changes significantly depending on the cell's function and environment. Liver and muscle cells have significantly different proteomes due to the specialization of proteins necessary for their respective functions.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Genomic Sequences
The genomic sequence of an organism consists of the complete set of DNA, encompassing every genetic instruction for development and function. For humans, this means encoding information for everything from eye color to metabolic processes. Despite the vast diversity of activities carried out by different cells in the body, the genomic sequence remains consistent across all cell types. This consistency exists because every cell originates from a common ancestor, the fertilized egg, which divides and differentiates while maintaining the foundational DNA. In essence, while the cells in your liver and muscles perform vastly different tasks, their genomic makeup is the same. The idea is that all instructions are present, but not all are needed, which links closely to the concept of gene expression.
Proteome Variability
While the genome is unchanging across different cells of an individual, the proteome is highly variable. The proteome refers to the complete set of proteins that are expressed at any given time in a cell, tissue, or organism. Unlike the genome, which remains constant, the proteome can change in response to various factors like cell type, environmental conditions, and developmental stage.

For instance, liver cells have a proteome rich in enzymes that assist in metabolism and detoxification, while muscle cells contain proteins like actin and myosin necessary for contraction and movement. This variability is essential for cells to perform specialized functions effectively. Thus, proteome variability is a reflection of the dynamic nature of cellular activity, adjusting continually to fulfill the unique requirements of each cell type.
Gene Expression
Gene expression is the process by which the information encoded in a gene is used to direct the assembly of a protein molecule. It involves two main stages: transcription and translation. During transcription, the DNA sequence of a gene is copied into messenger RNA (mRNA) which then travels out of the nucleus. In translation, this mRNA is used as a template to assemble proteins in the ribosome.

Not all genes are expressed in every cell; rather, a cell will express only those genes necessary for its unique function. This selective expression allows for specialization among cells—ensuring, for example, that liver cells focus on detoxifying substances while muscle cells are geared towards contraction. The regulation of this process is intricate and includes multiple levels of control, such as transcriptional, post-transcriptional, translational, and post-translational adjustments.
Cell Differentiation
Cell differentiation is the process through which a less specialized cell becomes a more specialized cell type. It's the reason why, despite all cells having identical genomes, they can become skin cells, neurons, or muscle fibers, each with distinct functions. Differentiation is a tightly regulated process influenced by gene expression. Differentiation cues stem from both intrinsic factors, like genes, and external signals, like those from neighboring cells and the environment.

As cells differentiate, they undergo changes in both structure and function, acquiring characteristics that enable them to perform specific tasks. This process involves the activation of certain gene sets while suppressing others, further illustrating the importance of gene expression in defining cell identity. Understanding differentiation is crucial in fields like developmental biology and medicine, especially with regards to regenerative therapies that aim to repair damaged tissues.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

James Noonan and his colleagues (J. Noonan et al. \(2005 .\) Science 309:597-599) set out to study the genome sequence of an extinct species of cave bear. They extracted DNA from 40,000 -year-old bones from a cave bear and used a metagenomic approach to isolate, identify, and sequence the cave-bear DNA. Why did they use a metagenomic approach when their objective was to sequence the genome of one species (the cave bear)?

Describe several different methods for inferring the function of a gene by examining its DNA sequence.

Explain how a reporter sequence can be used to provide information about the expression pattern of a gene.

A linear piece of DNA was broken into random, overlapping fragments and each fragment was sequenced. The sequence of each fragment is shown below. Fragment 1: \(5?–TAGTTAAAAC–3?\) Fragment 2: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 3: \(5?–CCCTAGTTAAAAC–3?\) Fragment 4: \(5?–ACCGCAATACCCTAGTT–3?\) Fragment 5: \(5?–ACCGCAATACCCTAGTTAAA–3?\) Fragment 6: \(5?–ATTTACCGCAAT–3\) On the basis of overlap in sequence, create a contig sequence of the original piece of DNA.

How does the density of genes found on chromosome 22 compare with the density of genes found on chromosome \(21,\) two similar-sized chromosomes? How does the number of genes on chromosome 22 compare with the number found on the Y chromosome? To answer these questions, go to www.ensembl.org. Under the heading Species, select Human. On the next page, click on View Karyotype. Pictures of the human chromosomes will appear. Click on chromosome 22 and select Chromosome Summary. You will be shown a picture of this chromosome and histograms of known genes (colored bars). The total numbers of coding (protein-encoding) genes, along with the chromosome length in base pairs, are given in the table at the bottom of the diagram. Write down the total length of the chromosome and the number of coding genes. Now go to chromosome 21 by selecting it from the Change Chromosome drop-down. Examine the total length and total number of protein-encoding genes for chromosome \(21 .\) Now do the same for the \(Y\) chromosome. Calculate the gene density (number of genes/length) for chromosomes \(22,21,\) and Y. a. Which chromosome has the highest density and greatest number of genes? Which has the fewest? b. Examine in more detail the genes at the tip of the short arm of the Y chromosome by clicking on the top bar in the histogram of genes. Jump to location view. A more detailed view will be shown. What known genes are found in this region? How many protein-encoding genes are there in this region?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.