/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Genetics: A Conceptual Approach Chapter 13 - (Page 2) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 12

How are transcription and replication similar, and how are they different?

Problem 13

How is transcription different in bacteria and eukaryotes? How is it similar?

Problem 14

An RNA molecule has the following percentages of bases: \(A=23 \%, U=42 \%, \mathrm{C}=21 \%, \text { and } \mathrm{G}=14 \%\) a. Is this RNA single stranded or double stranded? How can you tell? b. What would be the percentages of bases in the template strand of the DNA that contains the gene for this RNA?

Problem 17

The following sequence of nucleotides is found in a single-stranded DNA template: $$ATTGCCAGATCATCCCAATAGAT$$ Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA transcribed from this template.

Problem 18

RNA polymerases carry out transcription much more slowly than DNA polymerases carry out replication. Why is speed more important in replication than in transcription?

Problem 21

Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA ACGAAAA TCCTAAT TGCAATT

Problem 22

List at least five properties that DNA polymerases and RNA polymerases have in common. List at least three differences.

Problem 23

Most RNA molecules have three phosphate groups at the \(5^{\prime}\) end, but DNA molecules never do. Explain this difference.

Problem 24

Write a hypothetical sequence of bases that might be found in the first 20 nucleotides of a promoter of a bacterial gene. Include both strands of DNA and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of both strands. Be sure to include the transcription start site and any consensus sequences found in the promoter.

Problem 26

A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the sigma factor. The mutant bacteria produce a sigma factor that is unable to bind to RNA polymerase at elevated temperatures. What effect will this mutation have on the process of transcription when the bacteria are raised at elevated temperatures?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Biology Textbooks