/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 23 Most RNA molecules have three ph... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Most RNA molecules have three phosphate groups at the \(5^{\prime}\) end, but DNA molecules never do. Explain this difference.

Short Answer

Expert verified
RNA maintains 5' triphosphates from its synthesis process, unlike DNA which sheds them during synthesis.

Step by step solution

01

Understanding RNA Structure

RNA molecules often originate from ribonucleoside triphosphates, such as ATP, which inherently have three phosphate groups. During RNA synthesis, these triphosphates are retained at the 5' end, leading to the presence of a triphosphate group.
02

Understanding DNA Synthesis

DNA synthesis involves the use of deoxyribonucleoside triphosphates as well; however, during DNA replication, the triphosphate group is cleaved. Only a single phosphate group remains as a part of the phosphodiester bond, eliminating the possibility of a triphosphate group at the 5' end of DNA.
03

Conclusion

The fundamental difference arises from the molecular processes: RNA retains the triphosphate group during transcription, while DNA undergoes additional processing during replication that removes the excess phosphates.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Ribonucleoside Triphosphates
In the world of molecular biology, ribonucleoside triphosphates are the building blocks for RNA molecules. They are composed of a ribose sugar, a nitrogenous base, and three phosphate groups. These triphosphates are the source of energy for RNA polymerase during transcription. The most familiar is ATP, or adenosine triphosphate, which not only fuels cellular reactions but also serves as a nucleotide precursor for RNA synthesis.
During transcription, ribonucleoside triphosphates add nucleotides one by one to the growing RNA chain. Importantly, the triphosphate groups at the 5' end of RNA remain intact when an RNA strand is synthesized, giving RNA molecules their characteristic 5' triphosphate end. This helps in maintaining the stability and functionality of various RNA molecules in the cell.
Deoxyribonucleoside Triphosphates
Deoxyribonucleoside triphosphates (dNTPs) are crucial for DNA synthesis. They closely resemble ribonucleoside triphosphates but differ due to the absence of an oxygen atom on the ribose sugar (hence 'deoxy'). This small difference significantly alters the properties of DNA, resulting in its characteristic double-stranded helical structure.
In DNA replication, these dNTPs are incorporated into the growing DNA strand by DNA polymerase. During this process, only one of the three phosphate groups forms part of the DNA structure. The other two phosphates are cleaved off, which supplies the energy needed for the formation of a phosphodiester bond. Due to this removal process, DNA strands do not retain the triphosphate group at the 5' end.
Phosphodiester Bond
The phosphodiester bond is a pivotal linkage in both DNA and RNA strands. This bond connects the 3' carbon atom of one sugar molecule to the 5' carbon atom of the next sugar in the backbone via a phosphate group. This structure creates the sugar-phosphate backbone that is fundamental to the nucleotide chains that make up nucleic acids.
The formation of phosphodiester bonds is essential during processes like transcription and replication, as they stitch the nucleotides together to form continuous RNA or DNA molecules. The energy comes from the breaking of the two phosphates from triphosphate nucleotides, showing again why DNA doesn’t retain its triphosphate feature - the extra phosphates are used up to drive these crucial reactions.
5' End Structure
The 5' end structure is a key aspect of nucleic acid designations. In RNA, this end often retains its original triphosphate group from the initiating nucleoside triphosphates. This means that RNA generally displays a 5' triphosphate structure, which plays roles in processes such as mRNA recognition and stability within the cellular environment.
In contrast, DNA's 5' end does not typically exhibit a triphosphate. During the replication process, excess phosphate groups are cleaved to create energy necessary for forming the phosphodiester bonds. As a result, the 5' end of DNA is usually a monophosphate, highlighting a fundamental structural difference in RNA and DNA synthesis.
Molecular Processes in Transcription and Replication
Exploring the molecular processes in transcription and replication reveals insights into why RNA and DNA differ at their 5' ends. During transcription, ribonucleoside triphosphates are utilized to build RNA strands, and the triphosphate group is retained at the 5' end. This process happens in the nucleus where the DNA is being transcribed into RNA. In replication, deoxyribonucleoside triphosphates are used to assemble DNA strands. However, the processes differ as replication involves cleaving two phosphates from each incorporated nucleotide, utilizing the liberated energy to form phosphodiester linkages. This excision is necessary because it provides the energy that aids DNA polymerase in forming the growing DNA chain. These molecular processes emphasize the critical role of phosphate groups in nucleic acid synthesis and their varying functions in transcription and replication.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA ACGAAAA TCCTAAT TGCAATT

The following sequence of nucleotides is found in a single-stranded DNA template: $$ATTGCCAGATCATCCCAATAGAT$$ Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA transcribed from this template.

Give the names of the RNA polymerases found in eukaryotic cells and the types of RNA that they transcribe.

Through genetic engineering, a geneticist mutates the gene that encodes TBP in cultured human cells. This mutation destroys the ability of TBP to bind to the TATA box. Predict the effect of this mutation on cells that possess it.

Many genes in both bacteria and eukaryotes contain numerous sequences that can cause pauses in or premature termination of transcription. Nevertheless, the transcription of these genes within a cell normally produces multiple RNA molecules thousands of nucleotides long without pausing or premature termination. However, when a single round of transcription of these genes takes place in a test tube, RNA synthesis is frequently interrupted by pauses and premature terminations, which reduce the rate at which transcription takes place, and frequently shorten the lengths of the mRNA molecules produced. Most pauses and premature terminations occur when RNA polymerase temporarily backtracks (i.e., backs up) for one or two nucleotides along the DNA. Experimental findings have demonstrated that most pauses and premature terminations disappear if several RNA polymerases are simultaneously transcribing the DNA molecule. Propose an explanation for this observation of faster transcription and longer mRNAs when the template DNA is being transcribed by multiple RNA polymerases.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.