/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 17 The following sequence of nucleo... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 13: Problem 17

The following sequence of nucleotides is found in a single-stranded DNA template: $$ATTGCCAGATCATCCCAATAGAT$$ Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA transcribed from this template.

Short Answer

Expert verified
a. DNA template is 3' to 5'. b. RNA sequence: 5'-UAACGGUCUAGUAGGGUUAUCUA-3'.

Step by step solution

01

Determining the DNA Template Direction

The sequence provided is a DNA single strand: $$ATTGCCAGATCATCCCAATAGAT.$$ RNA polymerase reads the DNA template from the 3' (three prime) end to the 5' (five prime) end to synthesize RNA in the 5' to 3' direction. As such, the left side is the 3' end and the right is the 5' end.
02

Transcription to RNA Sequence

With the DNA template running 3' to 5', the RNA will be transcribed 5' to 3'. To find the RNA sequence, we replace each base in the DNA with its complementary RNA base: A with U, T with A, C with G, and G with C. Transcribing the given DNA gives us the RNA sequence: 5'-UAACGGUCUAGUAGGGUUAUCUA-3'.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA template
In the process of transcription, a DNA template serves as a guiding blueprint for synthesizing RNA. Think of it like a recipe book, where each DNA sequence contains instructions for building proteins. During transcription, the DNA template is read in the 3' to 5' direction.
This means the enzyme, RNA polymerase, has to align itself at one end of the DNA and proceed toward the other.
  • 3' end: The starting point for transcription, where RNA polymerase attaches and begins reading the template.
  • 5' end: The endpoint, marking the completion of the RNA sequence synthesis.
It鈥檚 important to remember that the DNA template dictates the sequence of the RNA鈥攁 key principle in gene expression.
RNA synthesis
Once the DNA template is ready, RNA synthesis can begin. This is the stage where the DNA instructions are transformed into an RNA strand. When RNA polymerase reads the DNA template, it matches complementary RNA nucleotides to the DNA bases. For example:
  • Adenine (A) in DNA pairs with Uracil (U) in RNA.
  • Thymine (T) pairs with Adenine (A).
  • Cytosine (C) pairs with Guanine (G).
  • Guanine (G) pairs with Cytosine (C).
The result is a growing RNA chain that reflects the gene in the DNA template, except it now can exit the nucleus to be translated into a protein. This process is fundamental to how cells express genetic information.
RNA polymerase
The enzyme RNA polymerase is crucial for the transcription process. Imagine it as a tiny machine operating within the cell, whose job is to assemble the RNA strand. It attaches to the DNA template at the three prime (3') end and moves towards the five prime (5') end.
  • Initiation: RNA polymerase binds to a specific region on the DNA called the promoter, which signals the start of a gene.
  • Elongation: As it moves along the DNA strand, RNA polymerase unwinds the DNA and zips in the RNA nucleotides that complement the DNA template.
  • Termination: The process ends when RNA polymerase reaches a termination signal in the DNA sequence, releasing the newly synthesized RNA.
RNA polymerase is highly efficient, ensuring that the right proteins are produced in the cell based on the genetic code found in the DNA.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Write the consensus sequence for the following set of nucleotide sequences. AGGAGTT AGCTATT TGCAATA ACGAAAA TCCTAAT TGCAATT

Most RNA molecules have three phosphate groups at the \(5^{\prime}\) end, but DNA molecules never do. Explain this difference.

Many genes in both bacteria and eukaryotes contain numerous sequences that can cause pauses in or premature termination of transcription. Nevertheless, the transcription of these genes within a cell normally produces multiple RNA molecules thousands of nucleotides long without pausing or premature termination. However, when a single round of transcription of these genes takes place in a test tube, RNA synthesis is frequently interrupted by pauses and premature terminations, which reduce the rate at which transcription takes place, and frequently shorten the lengths of the mRNA molecules produced. Most pauses and premature terminations occur when RNA polymerase temporarily backtracks (i.e., backs up) for one or two nucleotides along the DNA. Experimental findings have demonstrated that most pauses and premature terminations disappear if several RNA polymerases are simultaneously transcribing the DNA molecule. Propose an explanation for this observation of faster transcription and longer mRNAs when the template DNA is being transcribed by multiple RNA polymerases.

Draw an RNA nucleotide and a DNA nucleotide, highlighting the differences. How is the structure of RNA similar to that of DNA? How is it different?

The following diagram represents a transcription unit in a hypothetical DNA molecule. $$\begin{array}{l} \text { 5' } \ldots \text { TTGACA } \ldots \text { TATAAT } \ldots 3^{\prime} \\\ \text { 3' } \ldots \text { AACTGT } \ldots \text { ATATTA } \ldots 5^{\prime} \end{array}$$ a. On the basis of the information given, is this DNA from a bacterium or from a eukaryotic organism? b. If this DNA molecule is transcribed, which strand will be the template strand and which will be the nontemplate strand? c. Where, approximately, will the transcription start site be?
See all solutions

Recommended explanations on Biology Textbooks

Substance Exchange

Read Explanation

Ecology

Read Explanation

Reproduction

Read Explanation

Plant Biology

Read Explanation

Microbiology

Read Explanation

Biological Processes

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.