/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 12 How are transcription and replic... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

How are transcription and replication similar, and how are they different?

Short Answer

Expert verified
Transcription and replication both synthesize nucleic acids using DNA as a template. Replication copies entire DNA molecules, has high fidelity, and uses DNA polymerase. Transcription creates RNA, is less accurate, and uses RNA polymerase.

Step by step solution

01

Identifying the common process

Both transcription and replication involve the synthesis of new nucleic acid chains. In both processes, DNA is used as a template. They both occur in the nucleus of eukaryotic cells.
02

Recognising enzyme involvement

Enzymes play crucial roles in both processes. DNA polymerase is the main enzyme in DNA replication, which synthesizes a complementary DNA strand. In transcription, RNA polymerase is the key enzyme and it synthesizes RNA from the DNA template.
03

Understanding the differences in function

Replication results in the creation of a complete copy of the entire DNA molecule. It ensures that each daughter cell receives a complete set of genetic material during cell division. In contrast, transcription results in the synthesis of RNA, which is used in protein synthesis.
04

Comparing the fidelity and proofreading

DNA replication has a high fidelity due to the proofreading ability of DNA polymerase, reducing the rate of errors. Meanwhile, transcription is less accurate as RNA polymerase lacks proofreading capability, leading to a higher error rate.
05

Identifying the outcome

The end product of replication is two identical DNA molecules, each with one old and one new strand, following the semi-conservative replication model. The end product of transcription is a single-stranded RNA molecule that is processed to become mRNA, tRNA, or rRNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Replication
DNA replication is a fundamental process that ensures each new cell receives an exact copy of the DNA. It occurs during the S phase of the cell cycle.
The process begins with helicases unzipping the double helix structure of DNA, creating two single strands that serve as templates.

A critical enzyme called DNA polymerase then joins free nucleotides to build a new strand complementary to each template. This results in two identical DNA molecules.
  • Each new DNA molecule consists of one original and one new strand, a mechanism known as semi-conservative replication.
The replication process is highly accurate to maintain genetic integrity from one generation to the next.
RNA Synthesis
RNA synthesis, also known as transcription, is the process by which RNA is created from a DNA template. This occurs in the nucleus of eukaryotic cells. The key enzyme involved is RNA polymerase.

During transcription, RNA polymerase binds to a specific region of the DNA, known as the promoter. It then unwinds the DNA and reads the template strand to synthesize a complementary RNA molecule. The sequence of RNA synthesized can be mRNA, tRNA, or rRNA depending on its function in the cell.
  • mRNA acts as a messenger carrying instructions from DNA to the cytoplasm for protein synthesis.
  • tRNA helps in the assembly of amino acids to form proteins.
  • rRNA combines with protein to form ribosomes.
The completion of transcription results in an RNA transcript that exits the nucleus to perform its functions in the cell.
Enzymes in Genetics
Enzymes are crucial players in genetic processes as they facilitate and regulate the synthesis of both DNA and RNA. Without these enzymes, the biological processes of replication and transcription would not proceed efficiently.
In **DNA replication**, DNA polymerase not only synthesizes the new DNA strand but also checks for errors in a process called proofreading. This helps to prevent mutations.
In **RNA synthesis**, RNA polymerase synthesizes RNA but does not have the same ability to correct errors, which leads to a higher error rate compared to DNA replication.
  • DNA polymerase and RNA polymerase are specific to their respective processes, ensuring each process happens accurately and separately.
This specificity of enzymes is essential for maintaining the proper function of cellular activities.
Nucleus
The nucleus is the command center of a eukaryotic cell where both DNA replication and RNA synthesis occur. It controls cell activities by managing genes and storing genetic material.

The nuclear environment plays a protective role, keeping the DNA safe and allowing regulated access for processes like replication and transcription. Here, the DNA is found as chromatin, a complex of DNA and protein that becomes condensed into chromosomes during cell division.
  • As the site of genetic information processing, the nucleus ensures all genetic material is faithfully replicated and any instructions for proteins are accurately transcribed into RNA.
This compartmentalization within the nucleus is vital for maintaining genetic integrity over the life of the organism.
Fidelity in Genetic Processes
Fidelity in genetic processes refers to the accuracy with which DNA is replicated and RNA is transcribed. High fidelity is essential to prevent mutations that could lead to genetic diseases.
DNA replication exhibits high fidelity due to the proofreading function of DNA polymerase, which can backtrack and correct errors or mismatches. This mechanism is not infallible but significantly reduces the error rate.

Conversely, RNA synthesis operates with lower fidelity because RNA polymerase lacks such proofreading ability. Although errors in RNA do not directly result in permanent genetic changes, they can affect protein synthesis.
  • High fidelity in DNA replication ensures stable inheritance of genetic information.
  • The relative low fidelity in RNA synthesis can be tolerated because RNA molecules are transient and degraded once their function is complete.
The balance of fidelity in genetic processes safeguards life's continuity while allowing adaptable responses to environmental changes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The following sequence of nucleotides is found in a single-stranded DNA template: $$ATTGCCAGATCATCCCAATAGAT$$ Assume that RNA polymerase proceeds along this template from left to right. a. Which end of the DNA template is \(5^{\prime}\) and which end is \(3^{\prime} ?\) b. Give the sequence and identify the \(5^{\prime}\) and \(3^{\prime}\) ends of the RNA transcribed from this template.

A strain of bacteria possesses a temperature-sensitive mutation in the gene that encodes the sigma factor. The mutant bacteria produce a sigma factor that is unable to bind to RNA polymerase at elevated temperatures. What effect will this mutation have on the process of transcription when the bacteria are raised at elevated temperatures?

What are the three basic stages of transcription? Describe what happens at each stage.

Through genetic engineering, a geneticist mutates the gene that encodes TBP in cultured human cells. This mutation destroys the ability of TBP to bind to the TATA box. Predict the effect of this mutation on cells that possess it.

In Glenn Croston and his colleagues studied the relation between chromatin structure and transcription activity. In one set of experiments, they measured the level of in vitro transcription of a Drosophila gene by RNA polymerase II in the presence of DNA and various combinations of histone proteins (G. E. Croston et al. 1991. Science 251:643-649). First, they measured the level of transcription of naked DNA, with no associated histone proteins. Then they measured the level of transcription after nucleosome octamers (without H1) were added to the DNA. The addition of the octamers caused the level of transcription to drop by \(50 \% .\) When both nucleosome octamers and H1 proteins were added to the DNA, transcription was greatly repressed, dropping to less than \(1 \%\) of that obtained with naked DNA, as shown in the table below. GAL4-VP16 is a protein that binds to the DNA of certain eukaryotic genes. When GAL4-VP16 is added to DNA, the level of transcription by RNA polymerase II is greatly elevated. $$\begin{array}{cc} \text { Treatment } & \text { Relative amount of } \\ \text {} & \text { transcription }\\\ \text { Naked DNA } & 100 \\ \text { DNA + octamers } & 50 \\ \text { DNA + octamers \(+\mathrm{H}_{1}\) } & <1 \\ \text { DNA + GAL4-VP16 } & 1000 \\ \text { DNA + octamers + GAL4-VP16 } & 1000 \\ \text { DNA + octamers \(+\mathrm{H} 1+\) GAL4-VP16 } & 1000\\\ \end{array}$$ Even in the presence of the H1 protein, GAL4-VP16 stimulates high levels of transcription. Propose a mechanism by which the H1 protein represses transcription and by which GAL4-VP16 overcomes this repression. Explain how your proposed mechanism would produce the results obtained in these experiments.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.