/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Q. 17 In any given species, there are ... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 15: Q. 17 (page 392)

In any given species, there are at least how many types of aminoacyl tRNA synthetases? a. 20 b. 40 c. 100 d. 200

Short Answer

Expert verified

Option a is correct.

Step by step solution

01

Step 1. Introduction

Aminoacetyl tRNA is a substrate of translation and it plays a significant role in determining how genetic cod are read and interpreted as an amino acids.

02

Step 2. Explanation of the correct option

Option a is correct because there are a total of 20 aminoacyl tRNA synthetases.

03

Step 3. Explanation of the incorrect option

Option b is correct because there are a total of 20 aminoacyl tRNA synthetases instead of 40.

Option c is correct because there are a total of 20 aminoacyl tRNA synthetases instead of 100.

Option d is correct because there are a total of 20 aminoacyl tRNA synthetases instead of 200.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Three different bacteria species have the following consensus sequences upstream of a conserved gene.

Table 15.2 Order the bacteria from most to least efficient initiation of gene transcription. a. A > B > C b. B > C > A c. C > B > A d. A > C > B

The AUC and AUA codons in mRNA both specify isoleucine. What feature of the genetic code explains this?

a. complementarity

b. nonsense codons

c. universality

d. degeneracy

What processing step enhances the stability of pretRNAs and pre-rRNAs?

a. methylation

b. nucleotide modification

c. cleavage

d. splicing

Which pre-mRNA processing step is important for initiating translation?

a. poly-A tail

b. RNA editing

c. splicing

d. 7-methylguanosine cap

A scientist sequencing mRNA identifies the following strand: CUAUGUGUCGUAACAGCCGAUGACCCG What is the sequence of the amino acid chain this mRNA makes when it is translated
See all solutions

Recommended explanations on Biology Textbooks

Biological Processes

Read Explanation

Biological Molecules

Read Explanation

Cell Cycle

Read Explanation

Responding to Change

Read Explanation

Microbiology

Read Explanation

Cells

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.