/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Q. 14 What processing step enhances th... [FREE SOLUTION] | 91影视

91影视

Log out

Learning Materials

Features

Discover

Chapter 15: Q. 14 (page 392)

What processing step enhances the stability of pretRNAs and pre-rRNAs?

a. methylation

b. nucleotide modification

c. cleavage

d. splicing

Short Answer

Expert verified

Option a is correct.

Step by step solution

01

Step 1. Introduction

The process through which information encoded in mRNA is translated into amino acid during protein synthesis is known as translation.

02

Step 2. Explanation of the correct option

Option a is correct because the methyl functional group is added to some bases of pre-RNA and pre-tRNA for stability. RNA methylation is the post-transcriptional level of regulation in which 鈥揅H3 moiety or methyl functional group is added for stability. It regulates the transcription of mRNA, nucleation, stability, and translation and as a result, it overall controls the expression of the proteins.

03

Step 3. Explanation of the incorrect options

Option b is incorrect because the modified nucleotide occurs in all three forms of RNA.

Option c is incorrect because Cleavage refers to division or separation. it may be exonucleolytic - removing the end nucleotide, or endonucleolytic - splitting the strand in two,

Option d is incorrect because splicing is the excision of introns and joining of exons to form mature messenger RNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91影视!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In your own words, describe the difference between rho-dependent and rho-independent termination of transcription in prokaryotes

A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation? a. Translation stalls after the initiation AUG codon is identified. b. The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites. c. The ribosome cannot interact with mRNAs. d. tRNAs cannot exit the E site of the ribosome

A normal mRNA that reads 5鈥� 鈥� UGCCAUGGUAAUAACACAUGAGGCCUGAAC鈥� 3鈥� has an insertion mutation that changes the sequence to 5鈥� -UGCCAUGGUUAAUAACACAUGAGGCCUGAAC鈥� 3鈥�. Translate the original mRNA and the mutated mRNA, and explain how insertion mutations can have dramatic effects on proteins. (Hint: Be sure to find the initiation site.)

The -10 and -35 regions of prokaryotic promoters are called consensus sequences because ________.

a. they are identical in all bacterial species b. they are similar in all bacterial species

c. they exist in all organisms

d. they have the same function in all organisms
See all solutions

Recommended explanations on Biology Textbooks

Ecosystems

Read Explanation

Biological Organisms

Read Explanation

Ecological Levels

Read Explanation

Astrobiological Science

Read Explanation

Cells

Read Explanation

Cellular Energetics

Read Explanation
View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.