/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} 7.question Which subunit of the E. coli pol... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Which subunit of the E. coli polymerase confers specificity to transcription?

a. α

b. β

c. β'

d. σ

Short Answer

Expert verified

E. coli DNA Polymerase I is a DNA-dependent DNA polymerase having 3′– 5' and 5′– 3′ exonuclease activity.

1-Nick DNA translation

Synthesis of the second strand of cDNA

subunit of E.coli polymerase confers transcription specificity.

Step by step solution

01

step-1: Introduction

E. coli DNA Polymerase I is a DNA-dependent DNA polymerase having 3′– 5' and 5′– 3′ exonuclease activity.

1-Nick DNA translation

2-Synthesis of the second strand of cDNA

02

step-2: Explanation of correct answer

Alternative (d) The transcription is given specificity by the Sigma unit ( σunit). Because it may attach and detach from the core enzyme, the RNA polymerase enzyme is a holoenzyme. The enzyme is directed to a specific binding or interaction site on DNA by thisσ unit. It identifies promoter consensus sequences to assist RNA polymerase in binding to DNA. This subunit starts the transcription process and then separates from the enzyme after it's started.

03

step-3: Explanation of incorrect answers

αAlpha unit (option a). RNA polymerase in prokaryotes is a holoenzyme. There are two units in this enzyme that are responsible for binding to promoter DNA and other transcription machinery factors.

β-Beta unit (option b). RNA polymerase in prokaryotes is a holoenzyme. The B unit of RNA polymerase is the second biggest subunit, and it is responsible for RNA production by binding to ribonucleoside triphosphate.

β'- Beta-dash unit (option c). The β'unit is the biggest subunit of RNA polymerase, and it is responsible for attaching to the DNA template strand and actively synthesising RNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A scientist introduces a mutation that makes the 60S ribosomal subunit nonfunctional in a human cell line. What would be the predicted effect on translation?

a. Translation stalls after the initiation AUG codon is identified.

b. The ribosome cannot catalyze the formation of peptide bonds between the tRNAs in the A and P sites.

c. The ribosome cannot interact with mRNAs.

d. tRNAs cannot exit the E site of the ribosome.

A fragment of bacterial DNA reads: 3’ –TACCTATAATCTCAATTGATAGAAGCACTCTAC– 5’ Assuming that this fragment is the template strand, what is the sequence of mRNA that would be transcribed? (Hint: Be sure to identify the initiation site.)

Which feature of promoters can be found in both prokaryotes and eukaryotes? a. GC box b. TATA box c. octamer box d. -10 and -35 sequences

A scientist observes that a cell has an RNA polymerase deficiency that prevents it from making proteins. Describe three additional observations that would together support the conclusion that a defect in RNA polymerase I activity, and not problems with the other polymerases, causes the defect.

Figure 15.16 Many antibiotics inhibit bacterial protein synthesis. For example, tetracycline blocks the A site on the bacterial ribosome, and chloramphenicol blocks peptidyl transfer. What specific effect would you expect each of these antibiotics to have on protein synthesis?

Tetracycline would directly affect:

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

Chloramphenicol would directly affect

a. tRNA binding to the ribosome

b. ribosome assembly

c. growth of the protein chain

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.