/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 11 A segment of DNA from the middle... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A segment of DNA from the middle of an \(E\). coli gene has the sequence below. Write the mRNA sequences that can be produced by transcribing this segment in either direction. CCGGCTAAGATCTGACTAGC

Short Answer

Expert verified
The mRNA sequences that are produced from the provided DNA sequence when transcribed in the 5' to 3' direction is 'GGCCGAUUCUAGACUGAUCG' and in the 3' to 5' direction is 'GCUAGUCAGATUUCAGCCGG'.

Step by step solution

01

Identify DNA sequence

To begin with, locate the DNA sequence that has been provided: CCGGCTAAGATCTGACTAGC.
02

Transcription in Direction 5' to 3'

To transcribe this DNA sequence in the 5' to 3' direction, match each DNA base with its RNA complement according to base-pairing rules, replacing Thymine(T) with Uracil(U) for RNA. Following the base-pairing rules, the transcribed mRNA sequence from 5' to 3' direction would be: 'GGCCGAUUCUAGACUGAUCG'.
03

Transcription in Direction 3' to 5'

Similarly, to transcribe this DNA sequence in the 3' to 5' direction, each DNA base will be replaced by its RNA complement according to base-pairing rules, again replacing Thymine(T) with Uracil(U) for RNA. The transcribed mRNA sequence from 3' to 5' direction would be: 'GCUAGUCAGATUUCAGCCGG'.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

RNA Sequence
The RNA sequence is a series of nucleotides composed of a sugar (ribose), a phosphate group, and a nitrogenous base. Unlike DNA which contains Thymine (T), RNA contains Uracil (U) in its place. During the process of transcription, an RNA sequence is synthesized from a DNA template. This sequence is crucial for the production of proteins in cells, as it dictates the specific order in which amino acids are assembled.

Considering the example given, if one were to transcribe the DNA segment CCGGCTAAGATCTGACTAGC, by following base-pairing rules, one would create two different RNA sequences depending on the directionality of transcription. This concept is pivotal in understanding how genetic information is transferred from DNA to RNA.
Base-Pairing Rules
In the context of transcription, the base-pairing rules dictate which nitrogenous bases on the RNA strand bind with the DNA template. These rules are critical for accurate mRNA synthesis and subsequent protein formation. In RNA, Adenine (A) pairs with Uracil (U), while Guanine (G) pairs with Cytosine (C).

When transcribing the example DNA segment, following the base-pairing rules ensures that the correct mRNA molecule is formed. For instance, G in DNA pairs with C in RNA, and C in DNA pairs with G in RNA. Thus, these rules guarantee the fidelity of the gene expression process, ensuring that the right proteins are made for cellular function.
Gene Expression
Gene expression is the process by which information from a gene is used to synthesize gene products like proteins, which carry out cell functions. This process begins with transcription, where an mRNA sequence is generated from a DNA template, and concludes with translation, where the mRNA is decoded to build polypeptide chains (proteins).

Using the given DNA segment, transcriptional synthesis of mRNA represents the first step in expressing the gene encoded in the DNA. This is a highly regulated process ensuring that cells produce proteins only when they are needed. Misregulation of gene expression can lead to a variety of diseases, which highlights the importance of understanding the mechanisms that govern this process.
mRNA Synthesis
mRNA synthesis, also known as transcription, is the process of creating a single-stranded RNA copy of a segment of DNA. Transcription initiates when RNA polymerase binds to a promoter region on the DNA and proceeds to unwind the DNA strands. As RNA polymerase moves along the DNA template strand, RNA nucleotides are added complementary to the DNA sequence.

In the exercise, two possible mRNA sequences can be produced depending on the direction in which RNA polymerase transcribes the gene. The correct pairing and alignment guided by base-pairing rules result in an accurate mRNA strand. This strand is a messenger that carries the genetic code from the DNA in the nucleus to the ribosomes in the cytoplasm, where proteins are synthesized.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.