/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 56 Assuming that genes and SNPs are... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Assuming that genes and SNPs are distributed evenly throughout the human genome, estimate how many protein-coding genes are likely to differ between two individuals.

Short Answer

Expert verified
A few hundred to a few thousand protein-coding genes may differ between two individuals due to SNPs.

Step by step solution

01

Understand the background information

The human genome contains approximately 20,000 protein-coding genes. Single Nucleotide Polymorphisms (SNPs) are variations in a single nucleotide within the genome, and these tend to occur approximately once every 1,000 base pairs.
02

Calculate the total number of base pairs

The human genome is approximately 3 billion base pairs in size. This is the total genome size that will help to distribute the SNPs evenly throughout the genome.
03

Estimate number of SNPs between two individuals

It is known that, on average, there are about 3 million SNP differences between any two individuals. This is calculated as 1 SNP per 1,000 base pairs across 3 billion base pairs.
04

Relate SNPs to protein-coding genes

To estimate the number of protein-coding genes that differ between two individuals, consider that SNPs are randomly distributed throughout the genome. If each SNP has a chance to affect a protein-coding gene, then we can estimate how many genes differ based on SNP distribution.
05

Calculate the probability of SNPs affecting protein-coding genes

If there are about 3 million SNPs, and 20,000 protein-coding genes, then on average, each gene could potentially be affected by roughly 3 million SNPs divided by 20,000 genes, which is approximately 150 SNPs per gene.
06

Estimate affected protein-coding genes

To find how many genes likely differ between two individuals due to SNPs, assume each protein-coding gene can have changes due to these SNPs. With 150 SNPs potentially impacting each gene, most will not significantly alter the gene, but a fraction will likely cause differences. Thus, a conservative estimate might be that several hundred to a few thousand of these protein-coding genes could potentially have significant variations due to SNPs between two individuals.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Protein-Coding Genes
In our vast DNA landscape, protein-coding genes are the segments that truly stand out. They carry the instructions to produce proteins, which perform a wide array of functions necessary for life. Think of them as the recipes to create proteins, which are the workhorses in our cells.

Humans have about 20,000 protein-coding genes. Each of these genes is like a specialized blueprint, unique in what it builds. While this number might seem small compared to the entire genome, these genes account for a tiny fraction, just around 2% of the entire human DNA.

Interestingly, while all humans share the same set of genes, the slight variations in these genes contribute to individual differences. These differences can affect everything from eye color to how we metabolize food. When these genes vary between individuals, they might result in notable traits or might just cause minor changes.
Single Nucleotide Polymorphisms (SNPs)
Single Nucleotide Polymorphisms, or SNPs for short, are the most common type of genetic variation among people. Picture them as tiny typos in our DNA sequence. Each SNP represents a difference in a single nucleotide—the building blocks of DNA—at a specific position in the genome.

These variations occur roughly once every 1,000 base pairs, among the 3 billion base pairs of the human genome. This means there are about 3 million SNPs that distinguish any two people.

While most SNPs do not directly cause diseases or notable traits, some can influence the risk of developing certain diseases, how a person responds to bacteria, viruses, drugs, and other environmental influences. In research, SNPs can act as biological markers, helping scientists locate genes that are associated with disease.
Genomic Base Pairs
The basic building blocks of our genome are base pairs, which are pairs of nucleotides that form the structure of DNA. Imagine them like rungs on a ladder, connecting two DNA strands.

The human genome contains around 3 billion of these base pairs. These pairs are made up of four types of nucleotides: Adenine (A), Thymine (T), Cytosine (C), and Guanine (G). In the DNA structure, A pairs with T, and C pairs with G.

These enormous sequences of base pairs form the genetic code that determines how we are made and function. Base pairs are read in sequences of three, known as codons, each specifying a particular amino acid or signaling an instruction like "start" or "stop," which are critical in protein synthesis. This precise sequence allows for the intricate complexity of proteins and, by extension, the complexity of life.
Genetic Differences Between Individuals
Genetic differences among individuals are what make each person unique. These differences are brought about by variations in the genetic code, such as SNPs, and can manifest in many ways.

Even though humans share about 99.9% of their DNA, the 0.1% diversity leads to significant differences in physical characteristics, susceptibility to diseases, and responses to treatments.

This diversity is mostly due to the distribution of SNPs across the genome, which are scattered randomly. When SNPs occur in protein-coding regions or near genes, they may impact gene function or expression, contributing to phenotypic differences.

The estimation of how many protein-coding genes differ between people due to SNPs suggests a spectrum, from a few hundred to a few thousand, contributing to our rich tapestry of individual uniqueness. Such knowledge not only deepens our understanding of human diversity but also enhances personalized medicine, where treatments can tailor to an individual's genetic makeup.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Describe the chemical difference between uracil and thymine.

When genomes of various organisms were sequenced, biologists expected that the DNA content (the C-value) would always be positively correlated with organismal complexity. But no such correlation has been demonstrated. In fact, some plant and algae genomes are many times the size of the human genome. The C-value paradox is the term that refers to this puzzling lack of correlation between DNA content and organismal complexity. What questions do biologists need to ask as they attempt to solve the paradox?

A segment of the coding strand of a gene is shown below. ACACCATGGTGCATCTGACT a. Write the sequence of the complementary strand that DNA polymerase would make. b. Write the sequence of the mRNA that RNA polymerase would make from the gene segment.

A portion of a gene is shown below. 5'-ATGATTCGCCTCGGGGCTCCCCAGTCGCTGGTGCT- 3'-TACTAAGCGGAGCCCCGAGGGGTCAGCGACCACGA- GCTGACGCTGCTCGTCG-3 CGACTGCGACGAGCAGC-5 The sequence of the mRNA transcribed from this gene has the following sequence: 5 -AUGAUUCGCCUCGGGGCUCCCCAGUCGCUG- GUGCUGCUGACGCUGCUCGUCG-3 a. Identify the coding and noncoding strands of the DNA. b. Explain why only the coding strands of DNA are commonly published in databanks.

For many years, biologists and others have claimed that humans and chimpanzees are \(98 \%\) identical at the level of DNA. Both the human and chimp genomes, which are roughly the same size, have now been sequenced, and the data reveal approximately 35 million nucleotide differences between the two species. How does this number compare to the original claim?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.