/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 42 An E. coli phage replicase gene ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

An E. coli phage replicase gene has the mRNA initiation sequence shown below. Indicate the correct start codon and the Shine-Dalgarno sequence upstream of it. 5 -UAACUAGGAUGAAAUGCAUGUCUAAG \(\cdots\)

Short Answer

Expert verified
The Shine-Dalgarno sequence is 'UAACUAGG', and the start codon is 'AUG'.

Step by step solution

01

Understand the mRNA Sequence

The given mRNA sequence is 5'-UAACUAGGAUGAAAUGCAUGUCUAAG...'. We are looking for both the Shine-Dalgarno sequence and the start codon within this sequence to identify where translation begins.
02

Identify the Shine-Dalgarno Sequence

The Shine-Dalgarno (SD) sequence is typically located upstream of the start codon at a distance of about 3-10 nucleotides. It is a purine-rich region (rich in Adenine and Guanine) that is complementary to a sequence near the 3' end of the UCCUCCU ribosomal RNA. In our sequence, 'UAACUAGG' can function as the Shine-Dalgarno sequence, as it contains adjacent purines and is near the start codon.
03

Find the Start Codon

The start codon for translation in prokaryotic organisms is generally the sequence 'AUG'. In the given mRNA sequence, the first instance of 'AUG' appears right after the Shine-Dalgarno sequence. Specifically, 'AUG' starts at the 8th nucleotide position after 'UAACUAGG', indicating it as the start codon.
04

Verify Distance and Match

Make sure that the Shine-Dalgarno sequence 'UAACUAGG' is close enough, specifically 3-10 nucleotides upstream of the 'AUG' start codon, to ensure proper translation initiation. Indeed, the SD sequence is correctly positioned preceding the start codon 'AUG'.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Start Codon
In prokaryotic organisms, translation initiation begins with a special nucleotide sequence called the start codon. The most common start codon is 'AUG', which not only signals the beginning of protein synthesis but also codes for the amino acid Methionine in eukaryotes and initiator N-formylmethionine (fMet) in prokaryotes. Identifying the start codon is crucial for the translation process, as it establishes the reading frame for ribosomes to synthesize a protein correctly. In our mRNA sequence from the E. coli phage replicase gene, we locate the start codon 'AUG' immediately following the Shine-Dalgarno sequence.
  • Acts as a key signal marking the translation start site.
  • Defines the reading frame for the ribosome.
  • Ensures proper synthesis of the protein by coding for the initiator methionine.
Aligning with the downstream mRNA code, this initiator codon plays a pivotal role in decoding genetic information into a functional structure.
Shine-Dalgarno Sequence
The Shine-Dalgarno (SD) sequence is a crucial component in prokaryotic translation, found upstream of the start codon. It serves as a binding site for the ribosome on the mRNA strand, ensuring accurate alignment for translation initiation. This sequence is typically purine-rich, notably containing adenine (A) and guanine (G), and is complementary to the sequence at the 3' end of the 16S ribosomal RNA component of the small ribosomal subunit. In the E. coli mRNA example, 'UAACUAGG' acts as the SD sequence, positioned conveniently close to the start codon 'AUG'. Key aspects of the Shine-Dalgarno sequence:
  • Situated approximately 3-10 nucleotides upstream of the start codon.
  • Facilitates correct positioning of the ribosome for translation.
  • Helps in ensuring the start codon is placed in the P-site of the ribosome.
With precise interaction, the SD sequence augments the efficiency and accuracy of the translation process, shaping the foundation for protein synthesis.
Prokaryotic Translation
Prokaryotic translation is a sophisticated, multi-step process where ribosomes read mRNA to construct proteins. Unlike eukaryotic translation, which occurs in the cytoplasm and involves cell organelles like the endoplasmic reticulum, prokaryotic translation is more streamlined and occurs in the bacterial cytoplasm. This process begins with the ribosome binding to the Shine-Dalgarno sequence near the start codon on mRNA. Key characteristics of prokaryotic translation:
  • Utilizes a smaller 70S ribosome compared to the 80S ribosome in eukaryotes.
  • The initiator tRNA is charged with N-formylmethionine (fMet), specific to prokaryotes.
  • mRNA is polycistronic, often coding for multiple proteins from a single transcript.
Once the ribosome forms a complex with the mRNA at the correct location identified by the Shine-Dalgarno and start codon, it proceeds through elongation and termination, transforming genetic sequences into functional proteins at a rapid pace.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Identify the peptide encoded by the DNA sequence shown below (the top strand is the coding strand): CGATAATGTCCGACCAAGCGATCTCGTAGCA GCTATT ACAGGCTGGTTCGCT AGAGCATCGT

Cystic fibrosis is caused by a mutation in the 250,000 -bp CFTR gene. The mature CFTR mRNA is only 6129 nucleotides. a. Why is the mature mRNA so much shorter than the gene from which it was transcribed? b. What is the minimum number of nucleotides required to encode the 1480-residue CFTR protein?

Ribosomal inactivating proteins (RIPs) are RNA \(N\)-glycosidases found in plants. They catalyze the hydrolysis of specific adenine residues in RNA. RIPs are highly toxic but might be useful as antitumor drugs because ribosome synthesis is upregulated in transformed cells. Give a general explanation that describes how RIPs inactivate ribosomes.

In an experiment, \(>95 \%\) of the proteins are extracted from the \(50 S\) ribosomal subunit. Only the \(23 \mathrm{~S}\) rRNA and some protein fragments remain. Peptidyl transferase activity is unaffected. What can you conclude from these results? Propose a role for the protein fragments left behind. Why might it have been difficult to remove them?

The chaperone Hsp90 interacts with the tyrosine kinase domain of a growth factor receptor that has lost its ligand-binding domain but retains its tyrosine kinase domain (see Box 10.B). The antibiotic geldanamycin inhibits Hsp 90 function. What is the effect of adding geldanamycin to cells expressing the abnormal growth factor receptor?

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.