/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 51 Identify the peptide encoded by ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Identify the peptide encoded by the DNA sequence shown below (the top strand is the coding strand): CGATAATGTCCGACCAAGCGATCTCGTAGCA GCTATT ACAGGCTGGTTCGCT AGAGCATCGT

Short Answer

Expert verified
The peptide encoded is Arginine, Cysteine, Proline, Threonine, Lysine, Arginine, Serine, Arginine, Serine.

Step by step solution

01

Understanding the Coding Strand

The coding strand of DNA is used as a direct template to synthesize the corresponding mRNA strand, but with uracil (U) replacing thymine (T). The provided coding strand is: CGATAATGTCCGACCAAGCGATCTCGTAGCA. The space-separated sequence is used to represent codon separation for clarity later.
02

Transcribing the Coding DNA to mRNA

Replace each T in the coding strand with U to get the mRNA strand: CGA UAA UGU CCG ACC AAG CGA UCU CGU AGC A. Each set of three nucleotides in mRNA is called a codon and corresponds to an amino acid or a stop signal.
03

Dividing the mRNA into Codons

Divide the mRNA strand into codons (triplets of nucleotides): CGA | UAA | UGU | CCG | ACC | AAG | CGA | UCU | CGU | AGC | A.
04

Translating mRNA Codons to Amino Acids

Use a codon table to translate each mRNA codon into its corresponding amino acid: - CGA = Arginine (Arg) - UAA = Stop - UGU = Cysteine (Cys) - CCG = Proline (Pro) - ACC = Threonine (Thr) - AAG = Lysine (Lys) - CGA = Arginine (Arg) - UCU = Serine (Ser) - CGU = Arginine (Arg) - AGC = Serine (Ser).

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

mRNA synthesis
In the world of genetics, mRNA synthesis is a fundamental process that bridges the gap between DNA and proteins. This is the biological mechanism where the DNA sequence is "transcribed" into a complementary mRNA strand. Let's understand how this works. The initial step involves the transcription of a DNA strand, specifically the coding strand, into mRNA. The coding strand serves as a template to build the mRNA molecule, but with a small yet crucial modification: the thymine (T) bases in DNA are replaced by uracil (U) in mRNA.
This transformation is essential because mRNA carries the genetic information from DNA to the ribosomes, the protein factories of the cell. The spaces in the DNA sequence, as shown in our original problem, help visualize the boundaries of codons, which are pivotal in the next stages.
Each sequence of three mRNA nucleotides, a codon, is ready to be translated into an amino acid, the building blocks of proteins. This transition from DNA to mRNA is critical because it initiates the entire process of protein synthesis, making mRNA synthesis a foundational step in expressing genetic instructions.
codon to amino acid translation
The process of translating codons into amino acids is where mRNA's coded messages become functional proteins. After mRNA synthesis, the next phase is translation, where cellular machinery, namely ribosomes, reads the mRNA sequence in three-base segments known as codons. Each codon corresponds to a specific amino acid or a stop signal.
Translation occurs in the ribosome, a complex cellular machine that reads the mRNA strand codon by codon. This process begins at a start codon and continues until a stop codon is reached. For instance, in the step-by-step solution provided, codons like CGA translate to Arginine (Arg), while UAA signifies a stop signal with no corresponding amino acid.
  • CGA corresponds to Arginine (Arg)
  • UAA is a stop codon
  • UGU corresponds to Cysteine (Cys)
  • CCG corresponds to Proline (Pro)
  • ACC corresponds to Threonine (Thr)
  • AAG corresponds to Lysine (Lys)
  • UCU corresponds to Serine (Ser)
  • CGU corresponds to Arginine (Arg)
  • AGC corresponds to Serine (Ser)
These translations enable the cells to string together amino acids, forming long chains that then fold into proteins. Each protein has a specific function determined by its unique amino acid sequence, illustrating why the accurate translation from codons to amino acids is vital for cellular function.
genetic code
The genetic code is often dubbed the "language of life," as it dictates how genetic instructions in DNA are translated into the proteins that perform essential functions in living organisms. Encoded within the sequence of bases—adenine (A), cytosine (C), guanine (G), and thymine (T) in DNA, or uracil (U) in RNA—are instructions for forming amino acids, the building blocks of proteins.
The genetic code is universal and nearly identical across all forms of life, from the tiniest bacteria to humans. It is composed of 64 codons, each a triplet of nucleotides. This results in multiple codons often signifying the same amino acid, providing redundancy and a buffer against mutations that might otherwise have drastic effects.
This code includes start codons, like AUG, which signal the beginning of protein synthesis, and stop codons, such as UAA, UAG, and UGA, which terminate the process. Each codon is an instruction for adding a particular amino acid to the growing protein chain, or for stopping the assembly altogether.
Through this elegant and universal language, the genetic code translates the information stored in DNA and mRNA into the proteins vital for life's processes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The mammalian signal recognition particle (SRP) consists of one molecule of RNA and six proteins. In addition to interacting with the signal peptide, what might be the role of the RNA in the SRP?

Explain why a redundant genetic code helps protect an organism from the effects of mutations.

A tRNA molecule cannot be aminoacylated unless it bears a \(3^{\prime}\) CCA sequence. Many tRNA precursors are synthesized without this sequence, so a CCA-adding enzyme must append the three nucleotides to the \(3^{\prime}\) end of the immature tRNA molecule. a. The CCA-adding enzyme does not require a polynucleotide template. What does this imply about the mechanism for adding the CCA sequence? b. What can you conclude about the substrate specificity of the CCA-adding enzyme? c. Most CCA-adding enzymes consist of a single polymerase domain, but in one species of bacteria, the enzyme has two polymerase domains. Explain how this CCA-adding enzyme operates.

Organisms differ in their codon usage. For example, in yeast, only 25 of the 61 amino acid codons are used with high frequency. The cells contain high concentrations of the tRNAs that pair best with those codons, that is, form standard Watson-Crick base pairs. Explain how a point mutation in a gene, which does not change the identity of the encoded amino acid, could decrease the rate of synthesis of the protein corresponding to that gene.

Propose at least one hypothesis to explain why eukaryotic ribosomes are more complex than prokaryotic ribosomes.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.