Chapter 22: Problem 51
Identify the peptide encoded by the DNA sequence shown below (the top strand is the coding strand): CGATAATGTCCGACCAAGCGATCTCGTAGCA GCTATT ACAGGCTGGTTCGCT AGAGCATCGT
Short Answer
Expert verified
The peptide encoded is Arginine, Cysteine, Proline, Threonine, Lysine, Arginine, Serine, Arginine, Serine.
Step by step solution
01
Understanding the Coding Strand
The coding strand of DNA is used as a direct template to synthesize the corresponding mRNA strand, but with uracil (U) replacing thymine (T). The provided coding strand is: CGATAATGTCCGACCAAGCGATCTCGTAGCA. The space-separated sequence is used to represent codon separation for clarity later.
02
Transcribing the Coding DNA to mRNA
Replace each T in the coding strand with U to get the mRNA strand: CGA UAA UGU CCG ACC AAG CGA UCU CGU AGC A. Each set of three nucleotides in mRNA is called a codon and corresponds to an amino acid or a stop signal.
03
Dividing the mRNA into Codons
Divide the mRNA strand into codons (triplets of nucleotides): CGA | UAA | UGU | CCG | ACC | AAG | CGA | UCU | CGU | AGC | A.
04
Translating mRNA Codons to Amino Acids
Use a codon table to translate each mRNA codon into its corresponding amino acid:
- CGA = Arginine (Arg)
- UAA = Stop
- UGU = Cysteine (Cys)
- CCG = Proline (Pro)
- ACC = Threonine (Thr)
- AAG = Lysine (Lys)
- CGA = Arginine (Arg)
- UCU = Serine (Ser)
- CGU = Arginine (Arg)
- AGC = Serine (Ser).
Unlock Step-by-Step Solutions & Ace Your Exams!
-
Full Textbook Solutions
Get detailed explanations and key concepts
-
Unlimited Al creation
Al flashcards, explanations, exams and more...
-
Ads-free access
To over 500 millions flashcards
-
Money-back guarantee
We refund you if you fail your exam.
Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!
Key Concepts
These are the key concepts you need to understand to accurately answer the question.
mRNA synthesis
In the world of genetics, mRNA synthesis is a fundamental process that bridges the gap between DNA and proteins. This is the biological mechanism where the DNA sequence is "transcribed" into a complementary mRNA strand. Let's understand how this works. The initial step involves the transcription of a DNA strand, specifically the coding strand, into mRNA. The coding strand serves as a template to build the mRNA molecule, but with a small yet crucial modification: the thymine (T) bases in DNA are replaced by uracil (U) in mRNA.
This transformation is essential because mRNA carries the genetic information from DNA to the ribosomes, the protein factories of the cell. The spaces in the DNA sequence, as shown in our original problem, help visualize the boundaries of codons, which are pivotal in the next stages.
Each sequence of three mRNA nucleotides, a codon, is ready to be translated into an amino acid, the building blocks of proteins. This transition from DNA to mRNA is critical because it initiates the entire process of protein synthesis, making mRNA synthesis a foundational step in expressing genetic instructions.
This transformation is essential because mRNA carries the genetic information from DNA to the ribosomes, the protein factories of the cell. The spaces in the DNA sequence, as shown in our original problem, help visualize the boundaries of codons, which are pivotal in the next stages.
Each sequence of three mRNA nucleotides, a codon, is ready to be translated into an amino acid, the building blocks of proteins. This transition from DNA to mRNA is critical because it initiates the entire process of protein synthesis, making mRNA synthesis a foundational step in expressing genetic instructions.
codon to amino acid translation
The process of translating codons into amino acids is where mRNA's coded messages become functional proteins. After mRNA synthesis, the next phase is translation, where cellular machinery, namely ribosomes, reads the mRNA sequence in three-base segments known as codons. Each codon corresponds to a specific amino acid or a stop signal.
Translation occurs in the ribosome, a complex cellular machine that reads the mRNA strand codon by codon. This process begins at a start codon and continues until a stop codon is reached. For instance, in the step-by-step solution provided, codons like CGA translate to Arginine (Arg), while UAA signifies a stop signal with no corresponding amino acid.
Translation occurs in the ribosome, a complex cellular machine that reads the mRNA strand codon by codon. This process begins at a start codon and continues until a stop codon is reached. For instance, in the step-by-step solution provided, codons like CGA translate to Arginine (Arg), while UAA signifies a stop signal with no corresponding amino acid.
- CGA corresponds to Arginine (Arg)
- UAA is a stop codon
- UGU corresponds to Cysteine (Cys)
- CCG corresponds to Proline (Pro)
- ACC corresponds to Threonine (Thr)
- AAG corresponds to Lysine (Lys)
- UCU corresponds to Serine (Ser)
- CGU corresponds to Arginine (Arg)
- AGC corresponds to Serine (Ser)
genetic code
The genetic code is often dubbed the "language of life," as it dictates how genetic instructions in DNA are translated into the proteins that perform essential functions in living organisms. Encoded within the sequence of bases—adenine (A), cytosine (C), guanine (G), and thymine (T) in DNA, or uracil (U) in RNA—are instructions for forming amino acids, the building blocks of proteins.
The genetic code is universal and nearly identical across all forms of life, from the tiniest bacteria to humans. It is composed of 64 codons, each a triplet of nucleotides. This results in multiple codons often signifying the same amino acid, providing redundancy and a buffer against mutations that might otherwise have drastic effects.
This code includes start codons, like AUG, which signal the beginning of protein synthesis, and stop codons, such as UAA, UAG, and UGA, which terminate the process. Each codon is an instruction for adding a particular amino acid to the growing protein chain, or for stopping the assembly altogether.
Through this elegant and universal language, the genetic code translates the information stored in DNA and mRNA into the proteins vital for life's processes.
The genetic code is universal and nearly identical across all forms of life, from the tiniest bacteria to humans. It is composed of 64 codons, each a triplet of nucleotides. This results in multiple codons often signifying the same amino acid, providing redundancy and a buffer against mutations that might otherwise have drastic effects.
This code includes start codons, like AUG, which signal the beginning of protein synthesis, and stop codons, such as UAA, UAG, and UGA, which terminate the process. Each codon is an instruction for adding a particular amino acid to the growing protein chain, or for stopping the assembly altogether.
Through this elegant and universal language, the genetic code translates the information stored in DNA and mRNA into the proteins vital for life's processes.