/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 17 Why doesn't GlyRS need a proofre... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Why doesn't GlyRS need a proofreading domain?

Short Answer

Expert verified
GlyRS doesn't need a proofreading domain because glycine's simplicity minimizes mischarging risk.

Step by step solution

01

Understanding GlyRS Function

GlyRS stands for glycyl-tRNA synthetase, an enzyme responsible for attaching glycine to its corresponding tRNA during protein synthesis. This step ensures that glycine is added correctly according to the mRNA template.
02

Role of Proofreading in tRNA Synthetases

Proofreading is a quality control mechanism some tRNA synthetases use to remove mistakenly attached amino acids that do not correspond to the tRNA. This is important to prevent errors in protein synthesis.
03

Glycine's Unique Properties

Glycine is the smallest and simplest amino acid with no side chain to distinguish. Its small size reduces the chances of it being mistaken for another amino acid, thus minimizing the risk of mischarging.
04

GlyRS Accuracy Without Proofreading

Due to glycine's distinct simplicity, GlyRS likely achieves high fidelity in amino acid recognition and attachment without the need for extra proofreading. This simplifies GlyRS, as there's minimal error risk in glycine attachment.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Proofreading Mechanisms in Enzymatic Processes
Proofreading is an essential mechanism many enzymes use to ensure accuracy in biological processes. Think of it as a quality control step. Specifically, in the context of tRNA synthetases, proofreading helps remove any amino acids that may have been mistakenly attached to the wrong tRNA. This helps maintain the fidelity of protein synthesis.

For many aminoacyl-tRNA synthetases, proofreading involves several steps. Initially, the enzyme recognizes and binds the correct tRNA and amino acid. Then, if the wrong amino acid is attached, proofreading mechanisms detect and remove this error.

However, GlyRS, which is responsible for attaching glycine, a very small and simple amino acid, does not require a separate proofreading domain. This is largely because glycine's lack of a discernible side chain reduces the likelihood of misrecognition.
The Process of Protein Synthesis
Protein synthesis is the cellular process of building proteins, which are crucial for a wide range of functions in the body. This process occurs in two main stages: transcription and translation.

  • Transcription: This first stage involves copying a segment of DNA into mRNA. The mRNA carries the genetic information from the DNA in the nucleus to the ribosomes in the cytoplasm.
  • Translation: During this stage, the sequence encoded in mRNA is used to assemble a polypeptide chain, ultimately folding into a functioning protein. This takes place at the ribosome, where mRNA is read, and the corresponding tRNA molecules bring amino acids to form the protein chain.
GlyRS plays a crucial role in this translation process by ensuring that glycine is correctly attached to its corresponding tRNA. This attachment is based on the mRNA template, suggesting that each step in protein synthesis needs extreme precision to produce error-free proteins.
The Specificity of Amino Acid Recognition
Amino acid recognition is a critical aspect of cellular processes that ensures each amino acid is paired with the correct tRNA. The specificity of this process is determined by the structure of the amino acid and the corresponding enzyme binding sites.

GlyRS, an enzyme that handles glycine, doesn't require additional proofreading for recognition. Glycine, being the simplest amino acid, lacks a complex side chain, which helps GlyRS recognize and attach it more easily and accurately. This built-in simplicity reduces the potential for errors during the attachment process.

Other tRNA synthetases face challenges in recognizing more complex amino acids. These enzymes often have specialized domains that enhance specificity and proofreading functions to ensure proper protein synthesis. However, GlyRS can bypass these intricate mechanisms due to the straightforward nature of glycine, demonstrating how evolutionary efficiency is achieved in biological systems.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Identify the peptide encoded by the DNA sequence shown below (the top strand is the coding strand): CGATAATGTCCGACCAAGCGATCTCGTAGCA GCTATT ACAGGCTGGTTCGCT AGAGCATCGT

Mycobacteriophage genes occasionally begin with GUG or even more rarely, UUG (rather than \(\mathrm{AUG}\) ). Which amino acids correspond to these codons?

A tRNA molecule cannot be aminoacylated unless it bears a \(3^{\prime}\) CCA sequence. Many tRNA precursors are synthesized without this sequence, so a CCA-adding enzyme must append the three nucleotides to the \(3^{\prime}\) end of the immature tRNA molecule. a. The CCA-adding enzyme does not require a polynucleotide template. What does this imply about the mechanism for adding the CCA sequence? b. What can you conclude about the substrate specificity of the CCA-adding enzyme? c. Most CCA-adding enzymes consist of a single polymerase domain, but in one species of bacteria, the enzyme has two polymerase domains. Explain how this CCA-adding enzyme operates.

Calculate the approximate energetic cost (in kJ) for the ribosomal synthesis of one mole of a 20 -residue polypeptide. Why is the actual energetic cost in vivo probably higher than this value?

Protein engineers who study the effects of nonstandard amino acids on protein structure and function can use a cell-based system for synthesizing proteins containing nonstandard amino acids. In theory, a polypeptide containing the amino acid norleucine could be produced by cells growing in media containing high concentrations of norleucine and lacking norleucine's standard counterpart, leucine. CCCCC(N)C(=O)[O-] Experimental results have shown that peptides containing norleucine in place of leucine were not produced unless the cells contained a mutant LeuRS. Explain these results.

See all solutions

Recommended explanations on Chemistry Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.