/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Free solutions & answers for Essential Biochemistry Chapter 22 - (Page 4) [step by step] | 91Ó°ÊÓ

91Ó°ÊÓ

Problem 49

The bacterial elongation factors EF-Tu and EF-G are essential for translation in vivo, but bacterial ribosomes can translate mRNA into protein in vitro in the absence of \(\mathrm{EF}-\mathrm{Tu}\) and \(\mathrm{EF}-\mathrm{G}\). Why are these factors not required in vitro? How does their absence affect the accuracy of translation?

Problem 50

Predict the effect on protein synthesis if EF-Tu were able to recognize and form a complex with fMet-tRNA Met .

Problem 51

Identify the peptide encoded by the DNA sequence shown below (the top strand is the coding strand): CGATAATGTCCGACCAAGCGATCTCGTAGCA GCTATT ACAGGCTGGTTCGCT AGAGCATCGT

Problem 53

Calculate the approximate energetic cost (in kJ) for the ribosomal synthesis of one mole of a 20 -residue polypeptide. Why is the actual energetic cost in vivo probably higher than this value?

Problem 54

All cells contain an enzyme that hydrolyzes peptidyl-tRNA molecules that are not bound to a ribosome. Cells that are deficient in peptidyl-tRNA hydrolase grow very slowly. What is the function of this enzyme, which cleaves the peptidyl group from the tRNA? What does this tell you about the ability of ribosomes to carry out protein synthesis?

Problem 57

The rate of the peptidyl transferase reaction increases as the \(\mathrm{pH}\) increases from 6 to 8 . Use your knowledge of the peptidyl transferase reaction mechanism to explain this result.

Problem 59

Identify which terms are associated with transcription and which with translation: a. Promoter; b. TATA box; c. Shine-Dalgarno sequence; d. \(\sigma\) factor; e. \(-35\) region; f. \(\mathrm{AUG}\) codon; \(\mathrm{g}\). downstream promoter element (DPE).

Problem 61

A "nonsense suppressor" mutation results from a mutation in a tRNA anticodon sequence so that the tRNA can pair with a stop codon (also called a nonsense codon). a. What would be the effect of a nonsense suppressor mutation on protein synthesis in the cell? b. Would all of the cell's proteins be affected by the mutation? c. Could the aminoacyl-tRNA synthetase that aminoacylates the nonmutated tRNA play a role in minimizing the effects of a nonsense suppressor mutation?

Problem 63

In prokaryotes, translation can begin even before an mRNA transcript has been completely synthesized. Why is co-transcriptional translation not possible in eukaryotes?

Problem 64

The CFTR gene (see Problem 4) codes for the cystic fibrosis transmembrane conductance regulator. This protein functions as a chloride ion transporter in the cell membrane. What can you conclude about the identity of the first 20 or so amino acids in the newly synthesized CFTR polypeptide?

Access millions of textbook solutions in one place

  • Access over 3 million high quality textbook solutions
  • Access our popular flashcard, quiz, mock-exam and notes features
  • Access our smart AI features to upgrade your learning
Access millions of textbook solutions in one place

Recommended explanations on Chemistry Textbooks