/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 27 One strand of a gene in Arabidop... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

One strand of a gene in Arabidopsis thaliana has the following nucleotide sequence: atgagtgacgggaggaggaagaagagcgtgaacggaggtgcacc ggcgcaaacaatcttggatgatcggagatctagtcttccggaagtt gaagcttctccaccggctgggaaacgagctgttatcaagagtgcc gatatgaaagatgatatgcaaaaggaagctatcgaaatcgccatctcc gcgtttgagaagtacagtgtggagaaggatatagctgagaatata aagaaggagtttgacaagaaacatggtgctacttggcattgcattgtt ggtcgcaactttggttcttatgtaacgcatgagacaaaccatttcgtt tacttctacctcgaccagaaagctgtgctgctcttcaagtcgggttaa The function of this gene is still uncertain. (a) How might insertional mutagenesis be used to investigate its function? (b) Design an experiment using RNA interference to probe the function(s) of the gene.

Short Answer

Expert verified
(a) Use insertional mutagenesis to disrupt the gene and study phenotype changes. (b) Use RNA interference to knock down gene expression and observe effects.

Step by step solution

01

Understanding Insertional Mutagenesis

Insertional mutagenesis involves inserting a known nucleotide sequence into a target gene to disrupt its function. This can create a mutant phenotype that provides clues about the gene's role. In Arabidopsis thaliana, this can be done by using T-DNA insertional mutagenesis, where Agrobacterium tumefaciens is used to introduce T-DNA with a selectable marker, such as an antibiotic resistance gene, into the plant's genome, disrupting the gene of interest.
02

Using Insertional Mutagenesis

To apply insertional mutagenesis to investigate the gene's function, first, create a transformation vector with T-DNA. Transform Arabidopsis thaliana competent cells with this vector using Agrobacterium. Screen transformed plants for insertions within the target gene using PCR. Observe any phenotypic changes in the mutants to infer possible functions of the disrupted gene.
03

Understanding RNA Interference (RNAi)

RNA interference (RNAi) is a technique used to silence gene expression. It involves introducing double-stranded RNA that matches the target gene, leading to its degradation and suppression of gene expression. In the case of Arabidopsis thaliana, this can be employed to reduce or knock down the expression of the gene to study its function.
04

Designing an RNAi Experiment

Develop a short hairpin RNA (shRNA) or a double-stranded RNA (dsRNA) targeting the gene of interest. Clone it into a plant expression vector under a suitable promoter. Introduce the vector into Arabidopsis thaliana using Agrobacterium-mediated transformation. After confirming the RNAi construct integration, analyze plants for gene knockdown via quantitative PCR and study any resultant phenotypic changes to determine the gene’s role.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Insertional Mutagenesis
Insertional mutagenesis is a powerful technique used to alter a gene in order to study its function. Essentially, researchers insert an additional piece of DNA into the gene they want to investigate. This disrupts the function of that gene, resulting in changes, or phenotypes, in the organism. By observing these changes, scientists can deduce what the original gene might be doing without the disruption.
In the case of the model plant Arabidopsis thaliana, insertional mutagenesis is commonly carried out using a method called T-DNA insertion. Here's how it works:
  • Agrobacterium tumefaciens, a bacterium known for its ability to transfer DNA, is used to insert T-DNA into the plant's genome.
  • The T-DNA contains a selectable marker gene, such as one for antibiotic resistance, which helps identify successful transformations.
  • This disruption causes the gene to lose its original function, allowing researchers to observe and analyze the resulting phenotypic changes.
By observing the changes, scientists can gain clues about the role of the previously functioning gene.
RNA Interference
RNA interference (RNAi) is a technique used to silence or reduce the expression of specific genes. It relies on introducing RNA molecules that are complementary to the mRNA of the target gene, leading to the degradation of that mRNA. In effect, this prevents the production of the protein that the gene would normally encode.
The process of RNAi involves several steps:
  • Design a piece of RNA, typically in the form of a short hairpin RNA (shRNA) or double-stranded RNA (dsRNA), that matches the sequence of the target gene.
  • Clone this RNA sequence into a plant expression vector, ensuring it is under the control of a suitable promoter for gene expression.
  • Introduce this vector into the Arabidopsis thaliana using Agrobacterium transformation.
  • Once inside the plant, the synthesized RNA triggers the RNAi pathway, leading to the destruction of the target gene's mRNA.
  • Researchers use quantitative PCR to determine the extent of gene knockdown and examine the resultant phenotype for insights into gene function.
Using RNAi in this manner provides a controlled method to "turn off" specific genes, helping scientists understand their roles in development and physiology.
Arabidopsis thaliana
Arabidopsis thaliana is a small flowering plant that belongs to the mustard family, and it serves as a model organism in plant genetics and molecular biology. Its advantages as a research tool include its relatively short life cycle, small genome, and ease of cultivation and genetic manipulation.
Here are a few reasons why Arabidopsis thaliana is extensively used in scientific research:
  • Its genome was one of the first to be fully sequenced among plants, which provides a comprehensive genomic framework for studying plant functions.
  • The plant's small size and simple growth requirements make it economical to maintain in laboratory conditions.
  • Arabidopsis has a quick generation time, which allows for rapid experimentation and observation of genetic changes over several generations.
  • It has numerous well-characterized mutants and extensive online genetic resources, making it an invaluable resource for genetic studies.
Due to these factors, Arabidopsis thaliana continues to be a popular choice in the study of gene function and molecular genetics.
Gene Expression Silencing
Gene expression silencing refers to the process of suppressing or completely stopping the expression of a gene. This could mean reducing its mRNA levels or preventing the gene from being translated into a protein. Two common methods of achieving gene silencing are insertional mutagenesis and RNA interference (RNAi).
Insertional mutagenesis is a method that physically disrupts the gene, preventing it from performing its functions by blocking its transcription into mRNA.
RNAi, on the other hand, uses small RNA molecules to target and degrade mRNA from the gene of interest. This process effectively "silences" the gene by preventing the mRNA from being translated into its corresponding protein.
Gene silencing is crucial in research for several reasons:
  • It helps in investigating gene function by observing the effects of the absence of a particular gene's product.
  • Allows scientists to control gene expression in experiments to understand gene networks and interactions.
  • Plays a role in developing genetically modified crops and understanding plant disease resistance.
In summary, silencing is a key tool in the toolkit of genetic research, providing insight into myriad biological processes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Two men claim to be the father of baby Joyce Doe. Joyce's mother had her CODIS STR DNA profile analyzed and was homozygous for allele 8 at the TPOX locus (allele 8 contains eight repeats of the GAAT sequence at this polymorphic locus). Baby Joyce is heterozygous for alleles 8 and 11 at this locus. In an attempt to resolve the disputed paternity, the two men were tested for their STR DNA profiles at the TPOX locus on chromosome 2 . Putative father 1 was heterozygous for alleles 8 and 11 at the TPOX locus, and putative father 2 was homozygous for allele 11 at this locus. Can these results resolve this case of disputed paternity? If so, who is the biological father? If not, why not?

What are \(\mathrm{CpG}\) islands? Of what value are \(\mathrm{CpG}\) islands in positional cloning of human genes?

Transgenic mice are now routinely produced and studied in research laboratories throughout the world. How are transgenic mice produced? What kinds of information can be obtained from studies performed on transgenic mice? Does this information have any importance to the practice of medicine? If so, what?

Myotonic dystrophy (MD), occurring in about 1 of 8000 individuals, is the most common form of muscular dystrophy in adults. The disease, which is characterized by progressive muscle degeneration, is caused by a dominant mutant gene that contains an expanded CAG repeat region. Wild-type alleles of the \(M D\) gene contain 5 to 30 copies of the trinucleotide. Mutant \(M D\) alleles contain 50 to over 2000 copies of the CAG repeat. The complete nucleotide sequence of the \(M D\) gene is available. Design a diagnostic test for the mutant gene responsible for myotonic dystrophy that can be carried out using genomic DNA from newborns, fetal cells obtained by amniocentesis, and single cells from eight-cell pre-embryos produced by in vitro fertilization.

Many valuable human proteins contain carbohydrate or lipid components that are added posttranslationally. Bacteria do not contain the enzymes needed to add these components to primary translation products. How might these proteins be produced using transgenic animals?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.