/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 19 Many valuable human proteins con... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Many valuable human proteins contain carbohydrate or lipid components that are added posttranslationally. Bacteria do not contain the enzymes needed to add these components to primary translation products. How might these proteins be produced using transgenic animals?

Short Answer

Expert verified
Human genes are inserted into transgenic animals, which express the proteins with necessary modifications.

Step by step solution

01

Understand the Problem

The problem involves producing valuable human proteins that require posttranslational modification in the form of carbohydrates or lipids. These modifications cannot be performed by bacteria. Thus, we need to explore how transgenic animals can be used for this purpose.
02

Identify the Role of Transgenic Animals

Transgenic animals, such as transgenic mice, goats, or pigs, can be genetically modified to express human proteins. These animals have the cellular machinery necessary for proper posttranslational modifications, such as glycosylation and lipidation.
03

Genetic Engineering in Transgenic Animals

Introduce human genes that code for the desired proteins into the genome of an animal. This involves using techniques like microinjection, viral vectors, or CRISPR-Cas9 to insert human DNA into the animal's DNA. The animal will then produce the protein as part of its natural cellular processes.
04

Protein Harvesting and Processing

Once the transgenic animal expresses the human protein with the necessary posttranslational modifications, the protein can be harvested. Commonly, proteins could be secreted into the milk, blood, or other secretions of the animal, from which they can be purified and collected.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Posttranslational Modification
Posttranslational modification (PTM) refers to the chemical changes a protein undergoes after it is initially made, also known as post-synthesis. These changes are essential for the protein's full function, activity, stability, and localization within the organism. One common PTM is glycosylation, where carbohydrates are added to the protein, while another is lipidation, which involves attaching lipid molecules. These modifications help proteins become functionally active and are crucial for their overall effectiveness in biological systems. Various enzymes within the cell are responsible for carrying out these modifications, ensuring that proteins achieve their desired shape and functionality.

Using bacteria to produce human proteins is often limited due to their lack of the necessary enzymes for these modifications. This is where transgenic animals come into play. Transgenic animals possess the cellular machinery needed for accurate PTM, allowing them to produce human proteins with all requisite modifications, thus ensuring functional equivalency to naturally derived proteins in humans.
Genetic Engineering
Genetic engineering is a sophisticated technology that enables scientists to alter the genetic makeup of organisms by inserting, deleting, or modifying specific genes. This manipulation is fundamental to creating transgenic animals. To produce human proteins that require specific PTMs, scientists introduce the human gene coding for the desired protein into an animal's genome. This can be achieved through several techniques:
  • Microinjection: Directly injecting DNA into an animal egg.
  • Viral Vectors: Using viruses modified to carry the human gene into the host animal cells.
  • CRISPR-Cas9: Employing a precise gene-editing tool that cuts and inserts the human DNA sequence at the right place in the animal's DNA.
These genetic engineering techniques ensure that when the animal develops, it naturally produces the human protein. This includes any required posttranslational modifications, thereby enabling the production of complex human proteins in a live organism.
Protein Expression
Protein expression refers to the process through which cells produce proteins based on the genetic instructions carried by DNA. In transgenic animals, this expression also involves the insertion of additional genetic instructions, such as human genes, leading to the production of human proteins with appropriate PTMs.

Once the foreign DNA is integrated into the animal's genome, the animal begins to express the protein during its normal protein synthesis processes. These proteins are often secreted into easily accessible bodily fluids, like milk, blood, or urine, where they can be readily harvested. This approach allows for a sustainable and efficient method of producing proteins, offering a reliable alternative to human or microbial sources that lack adequate PTM capabilities. Notably, transgenic animals can continuously produce certain proteins over their lifetime, making this a robust strategy for large-scale protein production necessary for therapeutic and research purposes.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A human STR locus contains a tandem repeat \((\mathrm{TAGA})_{n}\) where \(n\) may be between 5 and \(15 .\) How many alleles of this locus would you expect to find in the human population?

A group of bodies are found buried in a forest. The police suspect that they may include the missing Jones family (two parents and two children). They extract DNA from bones and examine the DNA profiles of STR loci \(A\) and \(B,\) which are known to contain tandem repeats of variable length. They also analyze the DNA profiles of two other men. The results are shown in the following table where the numbers indicate the number of copies of the tandem repeat in a particular allele; for example, male 1 has one allele with 8 and another allele with 9 copies of a tandem repeat in locus $$\begin{array}{lll}\text { male 1 } & 8 / 9 & 5 / 7 \\ \text { male 2 } & 6 / 8 & 5 / 5 \\ \text { male 3 } & 7 / 10 & 7 / 7 \\ \text { woman } & 8 / 8 & 3 / 5 \\ \text { child 1 } & 7 / 8 & 5 / 7 \\ \text { child 2 } & 8 / 8 & 3 / 7\end{array}$$ Could the woman have been the mother of both children? Why or why not? Which man, if any, could have been the father of child 1 ?

Two men claim to be the father of baby Joyce Doe. Joyce's mother had her CODIS STR DNA profile analyzed and was homozygous for allele 8 at the TPOX locus (allele 8 contains eight repeats of the GAAT sequence at this polymorphic locus). Baby Joyce is heterozygous for alleles 8 and 11 at this locus. In an attempt to resolve the disputed paternity, the two men were tested for their STR DNA profiles at the TPOX locus on chromosome 2 . Putative father 1 was heterozygous for alleles 8 and 11 at the TPOX locus, and putative father 2 was homozygous for allele 11 at this locus. Can these results resolve this case of disputed paternity? If so, who is the biological father? If not, why not?

Most forensic experts agree that profiles of DNA from blood samples obtained at crime scenes and on personal items can provide convincing evidence for murder convictions. However, the defense attorneys sometimes argue successfully that sloppiness in handling blood samples results in contamination of the samples. What problems would contamination of blood samples present in the interpretation of DNA profiles? Would you expect such errors to lead to the conviction of an innocent person or the acquittal of a guilty person?

One strand of a gene in Arabidopsis thaliana has the following nucleotide sequence: atgagtgacgggaggaggaagaagagcgtgaacggaggtgcacc ggcgcaaacaatcttggatgatcggagatctagtcttccggaagtt gaagcttctccaccggctgggaaacgagctgttatcaagagtgcc gatatgaaagatgatatgcaaaaggaagctatcgaaatcgccatctcc gcgtttgagaagtacagtgtggagaaggatatagctgagaatata aagaaggagtttgacaagaaacatggtgctacttggcattgcattgtt ggtcgcaactttggttcttatgtaacgcatgagacaaaccatttcgtt tacttctacctcgaccagaaagctgtgctgctcttcaagtcgggttaa The function of this gene is still uncertain. (a) How might insertional mutagenesis be used to investigate its function? (b) Design an experiment using RNA interference to probe the function(s) of the gene.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.