/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 13 Most forensic experts agree that... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Most forensic experts agree that profiles of DNA from blood samples obtained at crime scenes and on personal items can provide convincing evidence for murder convictions. However, the defense attorneys sometimes argue successfully that sloppiness in handling blood samples results in contamination of the samples. What problems would contamination of blood samples present in the interpretation of DNA profiles? Would you expect such errors to lead to the conviction of an innocent person or the acquittal of a guilty person?

Short Answer

Expert verified
Contamination can lead to wrongful convictions and acquittals due to misleading DNA profiles.

Step by step solution

01

Understanding Contamination in DNA Samples

Contamination refers to the unintended inclusion of foreign DNA into a sample meant for analysis. When handling blood samples, if procedures are not followed strictly, external DNA can mix with the intended DNA sample and lead to inaccurate profiling.
02

Identifying Potential Issues with DNA Profiles

Contaminated samples can produce misleading DNA profiles that do not accurately represent the biological material from the crime scene. This may result in incorrect matching of profiles with suspects, either by mixing profiles of multiple individuals or by altering the original profile.
03

Assessing Impact on Conviction and Acquittal

Contamination could lead to convicting an innocent person if the DNA profile from contaminated samples wrongly matches the profile of an innocent individual. Conversely, a guilty person could be acquitted if the contamination obscures matches with their DNA profile, creating reasonable doubt about the evidence's reliability.
04

Potential Outcomes Due to DNA Sample Contamination

It’s possible that both wrongful accusations (convictions) and wrongful dismissals (acquittals) can result from contaminated DNA evidence. This reinforces the need for meticulous procedures in sample handling.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Contamination in DNA Samples
When we talk about contamination in DNA samples, we're discussing the reality of unintended foreign DNA finding its way into forensic DNA samples. This contamination can result from improper handling or storage of samples. It can happen when DNA from an analyst, equipment, or even other evidence mixes with the intended sample.
This can lead to the following problems:
  • Altered Results: A contaminated sample can lead to incorrect DNA profiling, giving misleading outcomes that do not truly represent the DNA from the crime scene.
  • Misleading Matches: If external DNA is introduced, the profile might wrongly match someone who had nothing to do with the crime. This could be due to an overlap of contaminated elements that mimic a suspect’s DNA.
  • Errors in Judgment: These errors are particularly problematic in legal contexts, where accurate evidence is crucial for justice.
That's why treating DNA samples with the utmost care and following strict protocols is vital for forensic validity.
DNA Profiling
DNA profiling is a scientific process used to identify individuals based on their DNA genetic material. Every person has unique DNA, except for identical twins, which makes DNA profiling a powerful tool in criminal investigations.
Here’s how the process typically works:
  • Collection: DNA samples are first collected from the crime scene. It could be from blood, hair, or any biological material that might hold DNA information.
  • Extraction: DNA is then extracted from these samples to prepare for further analysis.
  • Profiling: Using specific regions of DNA that vary between individual humans, scientists establish a unique DNA profile, kind of like a genetic fingerprint.
  • Comparison: The established DNA profile is then compared against samples from suspects to find matches.
This method allows forensic experts to place or exclude individuals from crime scenes, providing crucial insights into criminal cases. However, the accuracy of these results depends heavily on using uncontaminated samples.
Forensic Evidence Reliability
The reliability of forensic evidence, particularly DNA evidence, is critical to the justice system. It determines whether the evidence presented in a courtroom is accurate and can be trusted in making judicial decisions. DNA evidence is considered highly reliable because:
  • Unique Identity: DNA is unique to each individual, making it highly specific for identification.
  • Consistent Methods: Scientific methods used in DNA analysis are consistent and backed by research.
  • Strong Patterns: The probability of two people having the same DNA profile is extremely low, providing strong evidence.
However, these benefits can be compromised if DNA samples are contaminated. Contamination not only makes DNA profiles unreliable but also raises doubts about the entire forensic procedure. Hence, maintaining the integrity of forensic evidence through careful handling and analysis is crucial for its reliability in court.
Criminal Justice System
The criminal justice system relies heavily on accurate and reliable evidence to make fair and just decisions. DNA evidence plays a key role in this system by aiding in:
  • Identifying Suspects: DNA profiling helps identify suspects by matching crime scene samples to individuals.
  • Providing Proof: It provides strong proof of involvement or exclusion in crimes, being more direct than circumstantial evidence.
  • Preventing Miscarriages of Justice: With accurate DNA evidence, wrongful convictions can be avoided, and true criminals can be convicted.
That said, if DNA samples are contaminated, the reliability of this evidence is questioned. This can lead to wrongful convictions or even the acquittal of guilty parties due to the reasonable doubt created by the compromised evidence. Hence, the criminal justice system continually emphasizes proper collection and processing of DNA to uphold truth and fairness in its application.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Many valuable human proteins contain carbohydrate or lipid components that are added posttranslationally. Bacteria do not contain the enzymes needed to add these components to primary translation products. How might these proteins be produced using transgenic animals?

"Disarmed" retroviral vectors can be used to introduce genes into higher animals, including humans. What advantages do retroviral vectors have over other kinds of gene-transfer vectors? What disadvantages?

Transgenic mice are now routinely produced and studied in research laboratories throughout the world. How are transgenic mice produced? What kinds of information can be obtained from studies performed on transgenic mice? Does this information have any importance to the practice of medicine? If so, what?

One strand of a gene in Arabidopsis thaliana has the following nucleotide sequence: atgagtgacgggaggaggaagaagagcgtgaacggaggtgcacc ggcgcaaacaatcttggatgatcggagatctagtcttccggaagtt gaagcttctccaccggctgggaaacgagctgttatcaagagtgcc gatatgaaagatgatatgcaaaaggaagctatcgaaatcgccatctcc gcgtttgagaagtacagtgtggagaaggatatagctgagaatata aagaaggagtttgacaagaaacatggtgctacttggcattgcattgtt ggtcgcaactttggttcttatgtaacgcatgagacaaaccatttcgtt tacttctacctcgaccagaaagctgtgctgctcttcaagtcgggttaa The function of this gene is still uncertain. (a) How might insertional mutagenesis be used to investigate its function? (b) Design an experiment using RNA interference to probe the function(s) of the gene.

A group of bodies are found buried in a forest. The police suspect that they may include the missing Jones family (two parents and two children). They extract DNA from bones and examine the DNA profiles of STR loci \(A\) and \(B,\) which are known to contain tandem repeats of variable length. They also analyze the DNA profiles of two other men. The results are shown in the following table where the numbers indicate the number of copies of the tandem repeat in a particular allele; for example, male 1 has one allele with 8 and another allele with 9 copies of a tandem repeat in locus $$\begin{array}{lll}\text { male 1 } & 8 / 9 & 5 / 7 \\ \text { male 2 } & 6 / 8 & 5 / 5 \\ \text { male 3 } & 7 / 10 & 7 / 7 \\ \text { woman } & 8 / 8 & 3 / 5 \\ \text { child 1 } & 7 / 8 & 5 / 7 \\ \text { child 2 } & 8 / 8 & 3 / 7\end{array}$$ Could the woman have been the mother of both children? Why or why not? Which man, if any, could have been the father of child 1 ?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.