/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 1 What are \(\mathrm{CpG}\) island... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What are \(\mathrm{CpG}\) islands? Of what value are \(\mathrm{CpG}\) islands in positional cloning of human genes?

Short Answer

Expert verified
CpG islands are DNA regions rich in unmethylated CG dinucleotides; they help locate and identify gene regions in positional cloning.

Step by step solution

01

Understanding CpG Islands

CpG islands are regions of DNA where a cytosine nucleotide (C) is followed by a guanine nucleotide (G) in the linear sequence of bases along its 5' to 3' direction. These regions are typically 300 to 3,000 base pairs long, with a high frequency of CG dinucleotides.
02

Identifying Characteristics

CpG islands are often located near or within the promoters of genes, especially housekeeping genes. They are generally unmethylated, which is significant because methylation typically suppresses gene activity.
03

Role in Gene Expression

Since CpG islands are near promoters, they help regulate gene expression. Their unmethylated state allows transcription factors to bind, initiating transcription of the downstream gene.
04

Importance in Positional Cloning

In positional cloning, locating CpG islands can help identify gene start sites. Since these are often clues to the presence of a gene, finding CpG islands can guide researchers to the approximate location of genes.
05

Application in Human Genetics

In cloning human genes, researchers use CpG islands as markers. Their presence can speed up gene identification, especially when looking for genes involved in diseases, because they mark critical regulatory regions.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Positional Cloning
Positional cloning is a method used to identify and locate genes based on their position in the genome rather than their function. This technique is particularly valuable in finding genes linked to specific diseases or traits.
In the process of positional cloning, researchers often look for markers that can indicate the proximity to a gene of interest. CpG islands serve as effective markers because they are often situated near gene promoters, which are vital for gene activity.
  • Identification: Researchers scan the genome for regions with high frequencies of CpG islands.
  • Location: These islands frequently appear near the starts of genes, acting as signposts for further investigation.
CpG islands thus enhance the efficiency of positional cloning by highlighting potential gene locations and expediting the process of gene discovery.
Gene Expression
Gene expression is the biological process where genetic instructions in DNA are converted into functional products, such as proteins. The regulation of gene expression determines when and how genes are activated or suppressed in cells.
CpG islands play a crucial role in gene expression because they are commonly located near promoters of genes. Promoters are sequences that manage the rate of transcription initiation, a key step in expressing a gene.
  • Unmethylated CpG Islands: Most CpG islands are unmethylated and readily accessible for transcription factors.
  • Initiation: This accessibility helps initiate the transcription process, allowing the necessary proteins to be synthesized.
By understanding CpG islands, scientists can gain insights into the mechanisms that control gene expression and how these processes are altered in various conditions.
Promoters
Promoters are DNA sequences located upstream of a gene, playing a pivotal role in the regulation of that gene's transcription. These regions are crucial for determining when and how much a gene is expressed.
Many promoters are tightly associated with CpG islands, and this proximity is not incidental.
  • Binding Site: Promoters provide binding sites for transcription factors that are necessary to kick-start transcription.
  • Close Relationship: The presence of CpG islands within or near promoters often indicates regions of active gene expression.
Through their role in promoting gene transcription, CpG islands can serve as indicators of gene activity and are essential for understanding how genes are regulated across the genome.
Methylation
Methylation refers to the addition of a methyl group to DNA, often affecting the function and regulation of genes. This process typically occurs on cytosine bases in CpG dinucleotides in the genome.
Methylation has a significant impact on gene expression, usually leading to gene silencing.
  • Gene Suppression: Methylated CpG islands can prevent transcription factors from accessing the DNA, thereby inhibiting gene expression.
  • Tumor Suppression: Changes in DNA methylation patterns are associated with cancer, particularly when tumor suppressor genes are silenced.
CpG islands are generally unmethylated in normal conditions, especially in promoters of housekeeping genes, which need to remain active for cellular functions. Understanding methylation can help in studying both normal bodily functions and disease states.
DNA Sequencing
DNA sequencing is a technique used to determine the precise order of nucleotides within a DNA molecule. Understanding the sequence of DNA is vital for identifying genetic information and has numerous applications in research and medicine.
CpG islands are significant in DNA sequencing projects because they can highlight regions of high gene activity.
  • Gene Mapping: Sequencing can help identify CpG-rich areas which are often linked to genes.
  • Functional Insights: They provide clues about gene regulation and expression patterns.
Incorporating CpG islands in DNA sequencing efforts allows scientists to more effectively map genes, understand individual genetic variations, and explore the mechanisms behind gene-related diseases.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A group of bodies are found buried in a forest. The police suspect that they may include the missing Jones family (two parents and two children). They extract DNA from bones and examine the DNA profiles of STR loci \(A\) and \(B,\) which are known to contain tandem repeats of variable length. They also analyze the DNA profiles of two other men. The results are shown in the following table where the numbers indicate the number of copies of the tandem repeat in a particular allele; for example, male 1 has one allele with 8 and another allele with 9 copies of a tandem repeat in locus $$\begin{array}{lll}\text { male 1 } & 8 / 9 & 5 / 7 \\ \text { male 2 } & 6 / 8 & 5 / 5 \\ \text { male 3 } & 7 / 10 & 7 / 7 \\ \text { woman } & 8 / 8 & 3 / 5 \\ \text { child 1 } & 7 / 8 & 5 / 7 \\ \text { child 2 } & 8 / 8 & 3 / 7\end{array}$$ Could the woman have been the mother of both children? Why or why not? Which man, if any, could have been the father of child 1 ?

"Disarmed" retroviral vectors can be used to introduce genes into higher animals, including humans. What advantages do retroviral vectors have over other kinds of gene-transfer vectors? What disadvantages?

One strand of a gene in Arabidopsis thaliana has the following nucleotide sequence: atgagtgacgggaggaggaagaagagcgtgaacggaggtgcacc ggcgcaaacaatcttggatgatcggagatctagtcttccggaagtt gaagcttctccaccggctgggaaacgagctgttatcaagagtgcc gatatgaaagatgatatgcaaaaggaagctatcgaaatcgccatctcc gcgtttgagaagtacagtgtggagaaggatatagctgagaatata aagaaggagtttgacaagaaacatggtgctacttggcattgcattgtt ggtcgcaactttggttcttatgtaacgcatgagacaaaccatttcgtt tacttctacctcgaccagaaagctgtgctgctcttcaagtcgggttaa The function of this gene is still uncertain. (a) How might insertional mutagenesis be used to investigate its function? (b) Design an experiment using RNA interference to probe the function(s) of the gene.

Myotonic dystrophy (MD), occurring in about 1 of 8000 individuals, is the most common form of muscular dystrophy in adults. The disease, which is characterized by progressive muscle degeneration, is caused by a dominant mutant gene that contains an expanded CAG repeat region. Wild-type alleles of the \(M D\) gene contain 5 to 30 copies of the trinucleotide. Mutant \(M D\) alleles contain 50 to over 2000 copies of the CAG repeat. The complete nucleotide sequence of the \(M D\) gene is available. Design a diagnostic test for the mutant gene responsible for myotonic dystrophy that can be carried out using genomic DNA from newborns, fetal cells obtained by amniocentesis, and single cells from eight-cell pre-embryos produced by in vitro fertilization.

Transgenic mice are now routinely produced and studied in research laboratories throughout the world. How are transgenic mice produced? What kinds of information can be obtained from studies performed on transgenic mice? Does this information have any importance to the practice of medicine? If so, what?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.