/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 The generation of transgenic pla... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

The generation of transgenic plants using \(A\). tumefaciensmediated transformation often results in multiple sites of insertion. These sites frequently vary in the level of transgene expression. What approaches could you use to determine whether or not transgenic plants carry more than one transgene and, if so, where the transgenes are inserted into chromosomes?

Short Answer

Expert verified
Use Southern blot, FISH, PCR, and sequencing to identify multiple transgenes and their chromosome locations.

Step by step solution

01

Understanding Transgenes and Insertion

In transgenic plants, transgenes are the new genes inserted into the plant's genome. These genes can be inserted at one or multiple locations (insertion sites) within the chromosomes. To determine if a transgenic plant has multiple transgenes or insertion sites, we need effective molecular biology techniques.
02

Use of Southern Blot Analysis

Southern blotting is a method used to check for the presence and quantity of specific DNA sequences in a sample. Digest the plant DNA with restriction enzymes and separate the fragments using gel electrophoresis. Transfer the fragments onto a membrane and probe with a DNA sequence specific to the transgene. Multiple bands will indicate multiple insertion sites.
03

Fluorescent In Situ Hybridization (FISH)

This technique involves using a fluorescent probe that binds to a specific DNA sequence in the chromosomes. It helps to visualize where transgenes are located on the chromosomes through a microscope. This approach can confirm the specific chromosome and locus of transgene insertion.
04

Polymerase Chain Reaction (PCR)

PCR can quickly amplify specific DNA sequences associated with the transgenes. By designing primers specific to transgene sequences, PCR can confirm the presence of transgenes and potentially indicate the number of insertions based on the band pattern in gel electrophoresis.
05

Sequencing the Insertion Sites

With sequencing technologies like next-generation sequencing (NGS), each insertion site can be precisely characterized. Extract the genomic DNA, construct a library, and sequence it to determine the exact location and potentially the structure of insertions.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

A. tumefaciens-mediated transformation
A. tumefaciens-mediated transformation is a widely used technique in plant genetic engineering. This method utilizes the natural ability of the bacterium Agrobacterium tumefaciens to transfer DNA to plant cells. In nature, A. tumefaciens causes crown gall disease, which forms tumors on plants. Scientists harness this process to introduce new genes, or transgenes, into the plant genome.

During transformation, the transgene is inserted into the T-DNA region of a plasmid. This plasmid is then incorporated into A. tumefaciens, which is used to infect the plant tissue. Cells that successfully integrate the new genetic material are selected and regenerated into whole plants.

This technique is favored for its precision and efficiency in incorporating desired genes into a wide range of plant species. However, it may result in multiple insertions or variable sites of insertion, which requires further analysis to determine the exact number and position of transgenes in the plant genome.
Transgene Insertion
Transgene insertion refers to the integration of foreign DNA into the host plant's genome. This process is crucial for the production of genetically modified organisms (GMOs). Transgenes can insert at one or multiple sites within the plant genome, affecting how they are expressed.

After transformation, it is essential to verify whether the newly introduced genes are present and functional. The insertion sites can vary among different plants, leading to differences in gene expression levels. Identifying these sites can help predict how the transgenes will behave and their stability across plant generations.

Several molecular techniques can be employed to analyze transgene insertion sites, helping researchers understand and predict the impacts of these genetic changes. Techniques like Southern blot analysis, FISH, PCR, and sequencing provide detailed insights into where and how many times the transgenes are inserted.
Southern Blot Analysis
Southern blot analysis is a classic technique used to detect specific DNA sequences within a complex mixture. It helps in identifying and determining the number of transgene insertion sites within a plant genome.

The process begins with the extraction of plant genomic DNA, which is then digested using restriction enzymes. These enzymes cut the DNA into smaller fragments. The fragments are separated using gel electrophoresis, a method that sorts DNA by size.

Following separation, the DNA fragments are transferred onto a membrane and hybridized with a labeled probe. Probes are DNA sequences complementary to the transgene, allowing them to bind specifically to transgene-containing fragments.

After washing away unbound probes, the membrane is exposed to visualize the bands. These bands correspond to different transgene insertion sites. Multiple bands indicate multiple insertions, aiding in the analysis of transgenic plants.
Fluorescent In Situ Hybridization (FISH)
Fluorescent in situ hybridization (FISH) is a technique that allows for the precise visualization of chromosomal locations of transgenes within plant cells. It uses fluorescently labeled DNA probes that bind to specific DNA sequences under microscopic observation.

The process starts with preparing chromosome spreads from plant tissue. These spreads are then treated with probes specific to the transgene. Once the probe binds to the target DNA, the chromosomes can be visualized under a fluorescence microscope.

FISH not only shows if the transgene is present but also pinpoints the exact chromosomal location. This can verify the integration and stability of transgenes within the plant's genome. Knowing the precise localization is crucial for understanding the potential effects of the transgene on the plant's phenotype.
Polymerase Chain Reaction (PCR)
Polymerase chain reaction (PCR) is a rapid and highly sensitive technique used to amplify specific DNA sequences, making it a valuable tool for detecting transgenes in plants.

In PCR, short DNA fragments called primers bind to the transgene sequences. With the help of a DNA polymerase enzyme, multiple copies of this sequence are synthesized. This amplification makes it easy to detect even small amounts of transgenic DNA.

The amplified DNA is analyzed using gel electrophoresis. The presence and number of bands in the gel can confirm transgene presence and give an indication of the number of insertions. Because of its speed and ease of use, PCR is often one of the first steps in characterizing transgenic plants.
Sequencing Technologies
Sequencing technologies provide detailed insights into the DNA sequence of transgene insertion sites. These technologies can precisely determine the location and structure of transgene insertions within the plant genome.

Next-generation sequencing (NGS) is a widely used method for this purpose. It involves extracting genomic DNA, creating a library of short DNA fragments, and then sequencing these fragments using advanced machines.

This approach provides comprehensive information about the entire genome, including the exact position of transgenes. Identifying these positions helps researchers evaluate potential disruptions in gene function and expression.

While more expensive and time-consuming than other techniques, sequencing offers unparalleled accuracy and depth, making it a critical tool in the detailed analysis of transgenic plants.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

Most forensic experts agree that profiles of DNA from blood samples obtained at crime scenes and on personal items can provide convincing evidence for murder convictions. However, the defense attorneys sometimes argue successfully that sloppiness in handling blood samples results in contamination of the samples. What problems would contamination of blood samples present in the interpretation of DNA profiles? Would you expect such errors to lead to the conviction of an innocent person or the acquittal of a guilty person?

A group of bodies are found buried in a forest. The police suspect that they may include the missing Jones family (two parents and two children). They extract DNA from bones and examine the DNA profiles of STR loci \(A\) and \(B,\) which are known to contain tandem repeats of variable length. They also analyze the DNA profiles of two other men. The results are shown in the following table where the numbers indicate the number of copies of the tandem repeat in a particular allele; for example, male 1 has one allele with 8 and another allele with 9 copies of a tandem repeat in locus $$\begin{array}{lll}\text { male 1 } & 8 / 9 & 5 / 7 \\ \text { male 2 } & 6 / 8 & 5 / 5 \\ \text { male 3 } & 7 / 10 & 7 / 7 \\ \text { woman } & 8 / 8 & 3 / 5 \\ \text { child 1 } & 7 / 8 & 5 / 7 \\ \text { child 2 } & 8 / 8 & 3 / 7\end{array}$$ Could the woman have been the mother of both children? Why or why not? Which man, if any, could have been the father of child 1 ?

The Ti plasmid contains a region referred to as T-DNA. Why is this region called T-DNA, and what is its significance?

Two men claim to be the father of baby Joyce Doe. Joyce's mother had her CODIS STR DNA profile analyzed and was homozygous for allele 8 at the TPOX locus (allele 8 contains eight repeats of the GAAT sequence at this polymorphic locus). Baby Joyce is heterozygous for alleles 8 and 11 at this locus. In an attempt to resolve the disputed paternity, the two men were tested for their STR DNA profiles at the TPOX locus on chromosome 2 . Putative father 1 was heterozygous for alleles 8 and 11 at the TPOX locus, and putative father 2 was homozygous for allele 11 at this locus. Can these results resolve this case of disputed paternity? If so, who is the biological father? If not, why not?

One strand of a gene in Arabidopsis thaliana has the following nucleotide sequence: atgagtgacgggaggaggaagaagagcgtgaacggaggtgcacc ggcgcaaacaatcttggatgatcggagatctagtcttccggaagtt gaagcttctccaccggctgggaaacgagctgttatcaagagtgcc gatatgaaagatgatatgcaaaaggaagctatcgaaatcgccatctcc gcgtttgagaagtacagtgtggagaaggatatagctgagaatata aagaaggagtttgacaagaaacatggtgctacttggcattgcattgtt ggtcgcaactttggttcttatgtaacgcatgagacaaaccatttcgtt tacttctacctcgaccagaaagctgtgctgctcttcaagtcgggttaa The function of this gene is still uncertain. (a) How might insertional mutagenesis be used to investigate its function? (b) Design an experiment using RNA interference to probe the function(s) of the gene.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.