/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 16 Use the key provided below to de... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Use the key provided below to determine the amino acid sequence of the polypeptide produced from the following DNA sequence. Intron sequences are highlighted. Note: Not all amino acids in the key will be used. \(5^{\prime}\) TTCTAAACGCATGAAGCACCGICTCAGAGCCAGIGA \(3^{\prime}\) \(3^{\prime}\) AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT \(5^{\prime}\) \(\rightarrow\) Direction of DNA unwinding \\[\begin{array}{l}\text { Asn }=\mathrm{AAU} \mathrm{Cys}=\mathrm{TCG} \mathrm{Gly}=\mathrm{CAG} \text { I lis }=\mathrm{CAU} \mathrm{L} y \mathrm{s}=\mathrm{AAG} \\ \mathrm{Met}=\mathrm{AUG} \mathrm{Phe}=\mathrm{UUC} \mathrm{Ser}=\mathrm{AGC} \mathrm{Tyr}=\mathrm{UAC} \mathrm{Val}=\mathrm{GUC} ; \mathrm{GUA}\end{array}\\]

Short Answer

Expert verified
Phe-His-Glu-His-Arg

Step by step solution

01

Identify Template Strand

Given the direction of DNA unwinding \(3' \rightarrow 5'\), identify the template strand which will be used to transcribe mRNA. The template strand is the \(3' \) to \(5' \) strand: \(3' \) AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT \(5'\).
02

Transcribe DNA to mRNA

Use the template strand to transcribe the mRNA sequence by transcribing the complementary bases: A (DNA) pairs with U (mRNA), T with A, C with G, and G with C. - AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT becomes UUC UAA ACG CAU GAAGCACCGUCUCAUCGGGUCA.
03

Identify and Remove Introns

From the transcribed mRNA, identify sequences corresponding to introns. Usually introns are non-coding sequences removed through splicing. For simplification, consider removing any sections not matching the provided amino acid key.
04

Translate mRNA to Amino Acids

Translate the spliced mRNA sequence into amino acids using the key: - UUC = Phe - CAU = His - GAAG = Glu (not given in this key, but typically Glu for GAAG) - CAC = His - CGU = Arg (not given in this key, but typically Arg for CGU) This results in a polypeptide sequence: Phe-His-Glutamicacid-His-Arg.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Transcription
Transcription is the crucial first step in gene expression, where the information in a DNA strand is copied into messenger RNA (mRNA). This process is vital because it translates the genetic code into a format that can be utilized for protein synthesis. DNA unwinds, and the enzyme RNA polymerase plays a central role in transcribing the information. It reads the template DNA strand which runs from 3' to 5' and synthesizes the mRNA in the 5' to 3' direction.

During transcription, each DNA base (A, T, C, G) pairs with its complementary RNA base (U, A, G, C). For instance, in the provided DNA sequence: the template strand reads 3' to 5', and the mRNA synthesizes by aligning A with U, T with A, C with G, and G with C. This process forms the backbone for gene expression, ensuring that the genetic information is correctly converted into a transportable mRNA sequence that travels out of the nucleus for protein production.
Translation
Translation is the process through which the genetic code carried by mRNA is converted into a sequence of amino acids, forming a polypeptide chain. This step happens in the ribosome, where mRNA acts as a guide to produce the protein.

The mRNA is read in sets of three nucleotide bases called codons. Each codon corresponds to a specific amino acid, as indicated in the genetic code. For example, when mRNA codons such as UUC are read, they code for specific amino acids like Phenylalanine (Phe). It is the ribosome's responsibility to match these codons with the correct anticodons on tRNA, allowing the transfer RNA to bring in the appropriate amino acid. This orchestrated transfer results in the growth of the polypeptide chain.

The translation ensures that cellular machinery correctly interprets the mRNA message, converting it into functional proteins essential for life. It's a precise process, critical for synthesizing proteins that perform numerous biological tasks, from catalyzing metabolic reactions to supporting cellular structure.
Codon Usage
Codon usage refers to how frequently different codons are used by an organism to code for the 20 amino acids in proteins. Even though multiple codons can specify the same amino acid due to the degeneracy of the genetic code, different organisms display different preferences for which codon they use more frequently.

Understanding codon usage is essential for genetic engineering and synthetic biology. It allows scientists to optimize gene sequences for better protein expression in different host organisms, such as bacteria or yeast. The optimization process may involve altering the DNA sequence to match the preferred codon usage of the host while still encoding the same protein. This ensures more efficient protein synthesis and proper folding.

In practice, knowledge of codon usage is crucial when predicting mRNA's potential stability and translating efficiency. For instance, in the study of the exercise above, having a clear codon usage table allows one to accurately predict the amino acid sequence based on pre-defined codons, reflecting the high efficiency and specificity of the translation process. By understanding these codon preferences, biotechnology applications can be fine-tuned for maximum productivity and accuracy.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.