/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 15 You have learned about the event... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in the following scenarios. a. Helicases unwind the DNA, but stabilizing proteins are mutated and cannot bind to the DNA. b. The mRNA molecule forms a hairpin loop on itself via complementary base pairing in an area spanning the AUG start site. c. The cell is unable to produce functional tRNA Met

Short Answer

Expert verified
a. DNA replication stalls; b. Translation initiation is obstructed; c. Translation cannot start.

Step by step solution

01

Analyze Helicase's Role in DNA Replication

Helicases are enzymes that unwind the double-stranded DNA to create two single-stranded templates necessary for replication. They move along the DNA molecule, breaking the hydrogen bonds between the nucleotide base pairs. In normal conditions, stabilizing proteins, such as single-strand binding proteins, bind to these single strands to prevent them from reannealing or forming secondary structures.
02

Determine the Impact of Mutated Stabilizing Proteins

In this scenario, stabilizing proteins are mutated and cannot bind to the unwound DNA. Without these proteins, the single strands may reanneal or form secondary structures, hindering the progress of the replication fork and affecting the overall DNA replication process.
03

Evaluate the Formation of Hairpin Loop in mRNA

During transcription, the mRNA sequence should remain linear. If a hairpin loop forms via complementary base pairing in the area of the AUG start site, it can prevent ribosome binding, thus obstructing translation initiation. This structural obstruction can delay or inhibit protein synthesis.
04

Understand the Importance of Functional tRNA Met

In translation, tRNA molecules are responsible for transporting specific amino acids to the growing polypeptide chain. The tRNA Met carries the methionine required to start protein synthesis at the ribosome. If the cell cannot produce functional tRNA Met, the initiation of translation will be impeded, as methionine cannot be incorporated, preventing protein synthesis.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Helicases
Helicases play a crucial role in DNA replication by unwinding the double-stranded DNA, allowing each strand to be copied separately. They move along one strand of the DNA, separating it into two single strands by breaking the hydrogen bonds between the nucleotide bases. This process is essential because the DNA template strands need to be accessible for replication to occur.

Without helicases, the replication fork cannot progress. Helicases work hand in hand with other proteins, like single-strand binding proteins, which stabilize the unwound strands to prevent them from reannealing or forming any secondary structures, such as hairpins. If these stabilizing proteins are mutated and unable to bind to DNA, the replication process can be severely disrupted, leading to errors and mutations.

In summary:
  • Helicases unwind DNA by breaking hydrogen bonds.
  • They create single-stranded templates necessary for replication.
  • Stabilizing proteins work alongside helicases to prevent reannealing.
  • Mutations in these proteins can hinder the replication process.
mRNA Structure
The structure of mRNA is critical in the process of protein synthesis. The messenger RNA carries the genetic code from DNA to the ribosome, where proteins are synthesized. Ideally, mRNA remains in a linear form, which allows the ribosome to read the encoded information efficiently. However, specific structural changes can dramatically affect its function.

A hairpin loop occurs when the RNA strand folds back on itself and forms a double-stranded region through base pairing. Such a structure can arise if complementary sequences within the mRNA interact, and this often blocks important regulatory sites, such as the AUG start codon, crucial for the initiation of translation. This folding can prevent the ribosome from attaching to the mRNA and starting protein synthesis, leading to a stall in the entire process.

Key points:
  • mRNA should typically remain linear for correct translation.
  • Hairpin loops can form through inopportune base pairing.
  • These loops may hinder ribosome binding and halt protein synthesis.
tRNA Function
Transfer RNA (tRNA) is a vital player in the translation phase of protein synthesis. tRNAs transport specific amino acids to the ribosome, where proteins are assembled according to the sequence encoded in the mRNA. Each tRNA molecule has an anticodon sequence that is complementary to a codon on the mRNA, ensuring the proper insertion of each amino acid into the growing protein chain.

tRNA Met is particularly crucial as it carries the amino acid methionine, which is used as the starting amino acid for nearly all proteins. Without functional tRNA Met, the initiation of translation cannot proceed, causing a direct bottleneck in protein synthesis.

The essential roles of tRNA include:
  • Carrying amino acids to the ribosome.
  • Ensuring the correct pairing with mRNA codons through anticodons.
  • tRNA Met is needed to start protein synthesis with methionine.
  • Functionality issues in tRNA can block the entire translation process.
Central Dogma
The central dogma of molecular biology is a fundamental concept that describes the flow of genetic information within a biological system. It outlines the process whereby genetic information is transcribed from DNA to mRNA and then translated into a functional protein. This principle underscores the sequence of events that enable genetic information to control cellular activity and organismal development.

The process consists of two main stages: transcription and translation.
Transcription is the first step, involving the synthesis of a complementary RNA sequence from a DNA template. This newly formed mRNA carries the genetic instructions to the ribosome, where translation occurs.

During translation, the sequence of the mRNA is decoded by ribosomes to synthesize a specific protein, with tRNA molecules bringing the appropriate amino acids in sequence according to the mRNA codons.

In essence, the central dogma is:
  • DNA is transcribed to mRNA in the nucleus.
  • mRNA is translated into protein in the cytoplasm.
  • Ensures correct genetic information processing and expression.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

DNA repair systems are responsible for maintaining genomic fidelity in normal cells despite the high frequency with which mutational events occur. What type of DNA mutation is generated by (a) UV radiation and (b) ionizing radiation? Describe the system responsible for repairing cach of these types of mutations in mammalian cells. Postulate why a loss of function in one or more DNA repair systems typifies many cancers.

Use the key provided below to determine the amino acid sequence of the polypeptide produced from the following DNA sequence. Intron sequences are highlighted. Note: Not all amino acids in the key will be used. \(5^{\prime}\) TTCTAAACGCATGAAGCACCGICTCAGAGCCAGIGA \(3^{\prime}\) \(3^{\prime}\) AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT \(5^{\prime}\) \(\rightarrow\) Direction of DNA unwinding \\[\begin{array}{l}\text { Asn }=\mathrm{AAU} \mathrm{Cys}=\mathrm{TCG} \mathrm{Gly}=\mathrm{CAG} \text { I lis }=\mathrm{CAU} \mathrm{L} y \mathrm{s}=\mathrm{AAG} \\ \mathrm{Met}=\mathrm{AUG} \mathrm{Phe}=\mathrm{UUC} \mathrm{Ser}=\mathrm{AGC} \mathrm{Tyr}=\mathrm{UAC} \mathrm{Val}=\mathrm{GUC} ; \mathrm{GUA}\end{array}\\]

What are Watson-Crick base pairs? Why are they important?

The genome of a retrovirus can integrate into the hostcell genome. What gene is unique to retroviruses, and why is the protein encoded by this gene absolutely necessary for maintaining the retroviral life cycle? A number of retroviruses can infect certain human cells. List two of them, briefly describe the medical implications resulting from these infections, and describe why only certain cells are infected.

Contrast prokaryotic and eukaryotic gene characteristics.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.