/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 1 What are Watson-Crick base pairs... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What are Watson-Crick base pairs? Why are they important?

Short Answer

Expert verified
Watson-Crick base pairs are A-T and G-C. They are important for the stability and replication accuracy of DNA.

Step by step solution

01

Identifying Watson-Crick Base Pairs

Watson-Crick base pairs refer to the specific pairing between nucleotides in DNA. These are adenine (A) with thymine (T), and guanine (G) with cytosine (C). This pairing is always complementary, meaning that A pairs with T through two hydrogen bonds, and G pairs with C through three hydrogen bonds.
02

Understanding the Chemical Basis of Base Pairing

The pairing occurs due to the chemical structure of the nucleotides. Adenine can form two hydrogen bonds with thymine, and guanine can form three hydrogen bonds with cytosine. This hydrogen bonding is key to the stability and specificity of the DNA double helix structure.
03

Importance of Watson-Crick Base Pairs

These base pairs are crucial for DNA's integrity and function. They ensure accurate replication of genetic material: when DNA is copied, the base pairing ensures that each new DNA molecule is an exact copy of the original. Also, base pairing is critical for the process of transcription, where DNA is used as a template to synthesize RNA.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA structure
DNA, or deoxyribonucleic acid, is the molecule that holds genetic instructions vital for the growth, development, functioning, and reproduction of all living organisms and many viruses. The structure of DNA is known as a double helix, which resembles a twisted ladder.
  • The sides of this ladder are composed of alternating sugar (deoxyribose) and phosphate groups, forming a backbone.
  • The "rungs" of the ladder are made up of nitrogenous base pairs held together by hydrogen bonds.
The sequence of these bases encodes genetic information. The specific arrangement of these bases in sequences forms genes, which are the functional units of heredity. This unique structure of DNA is what allows it to store and transmit genetic information so effectively and is essential for cellular functions and inheritance.
hydrogen bonding
Hydrogen bonds are weak attractions that play a crucial role in stabilizing the DNA structure. These bonds occur between certain nitrogenous bases located opposite each other on the DNA strands.
  • Specifically, adenine (A) forms two hydrogen bonds with thymine (T).
  • Guanine (G), on the other hand, forms three hydrogen bonds with cytosine (C).
This variability in the number of hydrogen bonds contributes to the stability and the twist of the DNA double helix.
Hydrogen bonds, despite being weaker than covalent bonds, are strong in numbers and give DNA its flexible yet durable nature. They ensure that the DNA strands are held firmly together while allowing them to pull apart during processes like replication and transcription, maintaining the integrity of the genetic code.
genetic replication
Genetic replication is the process by which a cell duplicates its DNA, ensuring each new cell receives an identical set of chromosomes.
This process is crucial for growth, repair, and reproduction in living organisms. Replication is possible due to the specific pairing rules of Watson-Crick base pairs, with adenine pairing with thymine and guanine pairing with cytosine.
During replication, the DNA double helix unwinds, and each strand serves as a template for building a new complementary strand. Enzymes such as DNA polymerase help in adding new bases by following the base-pairing rules. This ensures the accuracy of the process, as the parental and newly synthesized strands join to create two identical DNA molecules, preserving the genetic information for the next generation.
transcription
Transcription is the first step in the expression of genes. It involves copying a segment of DNA into RNA, primarily messenger RNA (mRNA). This process begins when the DNA double helix unwinds, exposing the base pairs.
The RNA polymerase enzyme reads the DNA template and synthesizes a complementary strand of mRNA by following the Watson-Crick base pairing rules:
  • Adenine in DNA pairs with uracil in RNA instead of thymine.
  • Guanine continues to pair with cytosine.
This mRNA strand serves as a template for protein synthesis during translation. By acting as an intermediary between DNA and protein, transcription is fundamental for the functioning of cells, allowing the instructions carried by genes to be translated into the diverse proteins needed for various cellular functions.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

You have learned about the events surrounding DNA replication and the central dogma. Identify the steps associated with these processes that would be adversely affected in the following scenarios. a. Helicases unwind the DNA, but stabilizing proteins are mutated and cannot bind to the DNA. b. The mRNA molecule forms a hairpin loop on itself via complementary base pairing in an area spanning the AUG start site. c. The cell is unable to produce functional tRNA Met

Eukaryotes have repair systems that prevent mutations due to copying errors and exposure to mutagens. What are the three excision-repair systems found in eukaryotes, and which one is responsible for correcting thymine-thymine dimers that form as a result of UV light damage to DNA?

The DNA repair systems preferentially target the newly synthesized strand. Why is this important?

Use the key provided below to determine the amino acid sequence of the polypeptide produced from the following DNA sequence. Intron sequences are highlighted. Note: Not all amino acids in the key will be used. \(5^{\prime}\) TTCTAAACGCATGAAGCACCGICTCAGAGCCAGIGA \(3^{\prime}\) \(3^{\prime}\) AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT \(5^{\prime}\) \(\rightarrow\) Direction of DNA unwinding \\[\begin{array}{l}\text { Asn }=\mathrm{AAU} \mathrm{Cys}=\mathrm{TCG} \mathrm{Gly}=\mathrm{CAG} \text { I lis }=\mathrm{CAU} \mathrm{L} y \mathrm{s}=\mathrm{AAG} \\ \mathrm{Met}=\mathrm{AUG} \mathrm{Phe}=\mathrm{UUC} \mathrm{Ser}=\mathrm{AGC} \mathrm{Tyr}=\mathrm{UAC} \mathrm{Val}=\mathrm{GUC} ; \mathrm{GUA}\end{array}\\]

Contrast prokaryotic and eukaryotic gene characteristics.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.