/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 2 Preparing plasmid (double-strand... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

Preparing plasmid (double-stranded, circular) DNA for sequencing involves annealing a complementary, short, single-stranded oligonucleotide DNA primer to one strand of the plasmid template. This is routinely accomplished by heating the plasmid DNA and primer to \(90^{\circ} \mathrm{C}\) and then slowly bringing the temperature down to \(25^{\circ} \mathrm{C}\). Why does this protocol work?

Short Answer

Expert verified
The protocol works due to melting at high temperatures and specific annealing at lower ones.

Step by step solution

01

Understanding DNA Melting

At high temperatures, typically around 90°C, the hydrogen bonds between the DNA strands in the double helix break. This process is called denaturation or melting. At this stage, the plasmid DNA becomes single-stranded.
02

Primer Annealing Process

As the temperature is slowly decreased, the single-stranded DNA begins to cool and the complementary sequences can align with one another. At a lower temperature (around 25°C), the short single-stranded DNA primers can bind or anneal to the complementary sequence on the plasmid template.
03

Role of Complementary Base Pairing

The key to annealing is complementary base pairing, where adenine pairs with thymine and cytosine pairs with guanine. The primer's sequence is designed to specifically match a sequence on the plasmid, allowing it to attach only to the correct location as the temperature is lowered.
04

Conclusion: Why the Protocol Works

The gradual cooling process increases the chance for the primer to find its complementary sequence on the plasmid due to the decreased kinetic energy. This ensures specific binding, setting the stage for sequencing by allowing primers to anneal correctly on the plasmid template.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Denaturation
DNA denaturation is a crucial step in preparing DNA for various scientific processes, including sequencing. During denaturation, the DNA double helix unwinds and separates into two single strands. This occurs when the temperature is raised to about 90°C. At this high temperature, the hydrogen bonds holding the two strands together in the double helix break. This process is often referred to as "melting" of the DNA.

Understanding DNA denaturation is essential because it transforms the stable, double-stranded DNA into single strands that are necessary for sequencing. When the strands are separated, they can more easily interact with other components, such as primers, that are needed for the next steps in sequencing.

This process of separating the strands makes sure that each strand is accessible for subsequent actions. It's a bit like opening a book so you can read each page individually rather than trying to read through the closed cover. This stage lays critical groundwork for primer binding, which is a vital part of DNA sequencing.
Primer Annealing
Primer annealing occurs when the temperature of the system is gradually reduced after DNA denaturation. As the temperature drops to around 25°C, the short, single-stranded oligonucleotide DNA primers begin to attach themselves to their specific complementary sequence on the plasmid template. This step is key to ensuring that the primers bind to the correct section of DNA.

When primers anneal successfully, it sets the stage for further DNA synthesis. The sequence of the primer is meticulously crafted to match a unique sequence in the plasmid, allowing it to bind only at the intended site. This assures precision in the annealing process, reducing the chances of mismatches that can lead to sequencing errors.

The precision in primer annealing comes from the principle of complementary base pairing. By understanding how annealing works, we can appreciate how specific and sensitive this step is, enabling high-fidelity DNA replication in laboratory settings.
Complementary Base Pairing
Complementary base pairing is a fundamental concept in molecular biology that ensures the accurate formation of DNA double helix structures. In the context of DNA sequencing, complementary base pairing allows primers to bind precisely to their target sequences on the DNA template.

This process relies on the specific interactions between bases: adenine (A) pairs with thymine (T) and cytosine (C) pairs with guanine (G). Each base-pairing interaction is held together by hydrogen bonds, which are weaker than covalent bonds, but strong enough to stabilize the DNA structure.

During the primer annealing stage, a primer will only attach when its sequence is complementary to the sequence of the DNA strand it is intended to pair with. This specificity is what makes DNA sequencing possible because it allows the primer to bind tightly and accurately in preparation for DNA synthesis.
  • Adenine pairs with Thymine
  • Cytosine pairs with Guanine
Complementary base pairing ensures precision and stability in the formation of new DNA strands, as each new base added is checked for correct pairing, which is vital for accurate DNA replication and subsequent sequencing.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

The DNA repair systems preferentially target the newly synthesized strand. Why is this important?

How would a mutation in the poly(A)-binding protein gene affect translation? How would an electron micrograph of polyribosomes from such a mutant differ from the normal pattern?

Use the key provided below to determine the amino acid sequence of the polypeptide produced from the following DNA sequence. Intron sequences are highlighted. Note: Not all amino acids in the key will be used. \(5^{\prime}\) TTCTAAACGCATGAAGCACCGICTCAGAGCCAGIGA \(3^{\prime}\) \(3^{\prime}\) AAGATTTGCGTACTTCGTGGCAGAGTCTCGGTCACT \(5^{\prime}\) \(\rightarrow\) Direction of DNA unwinding \\[\begin{array}{l}\text { Asn }=\mathrm{AAU} \mathrm{Cys}=\mathrm{TCG} \mathrm{Gly}=\mathrm{CAG} \text { I lis }=\mathrm{CAU} \mathrm{L} y \mathrm{s}=\mathrm{AAG} \\ \mathrm{Met}=\mathrm{AUG} \mathrm{Phe}=\mathrm{UUC} \mathrm{Ser}=\mathrm{AGC} \mathrm{Tyr}=\mathrm{UAC} \mathrm{Val}=\mathrm{GUC} ; \mathrm{GUA}\end{array}\\]

The genome of a retrovirus can integrate into the hostcell genome. What gene is unique to retroviruses, and why is the protein encoded by this gene absolutely necessary for maintaining the retroviral life cycle? A number of retroviruses can infect certain human cells. List two of them, briefly describe the medical implications resulting from these infections, and describe why only certain cells are infected.

While investigating the function of a specific growth factor receptor gene from humans, researchers found that two types of proteins are synthesized from this gene. A larger protein containing a membranc-spanning domain recognizes growth factors at the cell surface, stimulating a spccific downstream signaling pathway. In contrast, a rclated, smaller protein is secreted from the cell and binds available growth factor circulating in the blood, thus inhibiting the downstream signaling pathway. Speculate on how the cell synthesizes these disparate proteins.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.