/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 34 What evidence supports the view ... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

What evidence supports the view that ribosomal RNAs are a more important component of the ribosome than the ribosomal proteins?

Short Answer

Expert verified
Ribosomal RNAs catalyze peptide bonds and form the ribosome's core structure, highlighting their primary functional importance over ribosomal proteins.

Step by step solution

01

Understanding Ribosomal Function

Begin by understanding what ribosomes do. Ribosomes are the cellular components that synthesize proteins. They are made up of ribosomal RNA (rRNA) and ribosomal proteins. The main function of ribosomes is to translate messenger RNA (mRNA) into proteins by linking amino acids together.
02

Ribosomal RNA's Role

Ribosomal RNAs form the core structure of the ribosome. They catalyze peptide bond formation, which is the key chemical reaction in protein synthesis. In fact, the site where the amino acids are linked together is made entirely of RNA, highlighting the catalytic role of rRNA.
03

Evidence from Structural Studies

X-ray crystallography studies of ribosomes have shown that the catalytic site of the ribosome, known as the "peptidyl transferase center," is composed solely of RNA. This direct involvement in catalysis is strong evidence of the crucial role of rRNA.
04

Evolutionary Conservation

rRNAs are highly evolutionarily conserved across different species, indicating their fundamental and essential role in ribosomal function. This contrasts with ribosomal proteins, which are less conserved and more numerous, suggesting they play supportive but less critical roles.
05

Supportive Role of Ribosomal Proteins

The primary role of ribosomal proteins is to stabilize the structure of the ribosome and assist rRNA folding, rather than directly participating in catalysis. This supports the view that rRNAs are more critical to function.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

The Role of rRNA in Ribosome Function
Ribosomal RNA, commonly known as rRNA, is a vital component of the ribosomal structure, serving as the cornerstone of protein synthesis within cells. Comprising the main framework of ribosomes, rRNA does not just provide structural support; it also plays an active and pivotal role in catalyzing the formation of peptide bonds. These bonds are essential in linking amino acids together during protein synthesis—the primary function of ribosomes.

One fascinating aspect of rRNA is that it composes the core component of the ribosome's catalytic site, known as the "peptidyl transferase center." Research studies, particularly those using X-ray crystallography, have illuminated the fact that this site comprises entirely of RNA.

Such structural insights underscore the indispensable catalytic role of rRNA, making it an essential player in translating genetic information into functional proteins. Indeed, the evolutionary conservation of rRNA across different species strongly argues for its critical function in maintaining life on the cellular level.
Insights into Protein Synthesis
Protein synthesis is the cell's process of making proteins, crucial for maintaining cellular structure and function. The ribosome orchestrates this entire process, using messenger RNA (mRNA) as a template. Essentially, it translates mRNA's genetic instructions to build specific proteins.

The core mechanisms of protein synthesis pivot on the ribosome's ability to effectively read and decode the sequence of codons in mRNA. This sequence dictates the order of amino acids, which are the building blocks of proteins.
  • The ribosome reads the mRNA sequence in steps called codons, each coding for a specific amino acid.
  • Transfer RNA (tRNA) brings the corresponding amino acids to the ribosome.
  • rRNA catalyzes the formation of peptide bonds between amino acids, forming a growing polypeptide chain.
The efficiency and accuracy of protein synthesis highlight the complex yet beautifully orchestrated nature of cellular activity within living organisms.
Understanding Ribosomal Proteins
Ribosomal proteins, while essential, primarily play a supportive role in the overall function of ribosomes. Comprising parts of both the small and large subunits of the ribosome, these proteins help maintain the correct shape and stability of the ribosomal structure, crucial for its functional integrity during protein synthesis.

Instead of directly participating in the catalysis process of peptide bond formation—handled by rRNA—ribosomal proteins focus on other tasks that assist in the overall efficiency of the ribosome. These roles can include:
  • Stabilizing the ribosomal RNA by promoting its proper folding.
  • Ensuring the mRNA and tRNA align correctly within the ribosome for accurate protein translation.
  • Contributing to the ribosome's ability to move along the mRNA strand, enhancing translation speed and accuracy.
Interestingly, the number and diversity of ribosomal proteins can vary significantly across species, further illustrating their primary function as supportive rather than catalytic. This variance contrasts with the highly conserved nature of rRNA, emphasizing rRNA’s critical function in ribosomal activity.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the \(5^{\prime}\) and the \(3^{\prime}\) ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be? d. Assume that the original molecule is intact and that the bottom strand is transcribed from left to right. Give the RNA base sequence, and label the \(5^{\prime}\) and \(3^{\prime}\) ends of the anticodon that inserts the fourth amino acid into the nascent polypeptide. What is this amino acid?

In vitro translation systems have been developed in which specific RNA molecules can be added to a test tube containing a bacterial cell extract that includes all the components needed for translation (ribosomes, tRNAs, amino acids). If a radioactively labeled amino acid is included, any protein translated from that \(\mathrm{RNA}\) can be detected and displayed on a gel. If a eukaryotic mRNA is added to the test tube, would radioactive protein be produced? Explain.

An in vitro translation system contains a eukaryotic cell extract that includes all the components needed for translation (ribosomes, tRNAs, amino acids). If bacterial RNA is added to the test tube, would a protein be produced? If not, why not?

A mutational event inserts an extra nucleotide pair into DNA. Which of the following outcomes do you expect? (1) No protein at all; (2) a protein in which one amino acid is changed; (3) a protein in which three amino acids are changed; (4) a protein in which two amino acids are changed; (5) a protein in which most amino acids after the site of the insertion are changed.

Why do multicellular eukaryotes need to have hundreds of kinase-encoding genes?

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.