/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 14 A mutational event inserts an ex... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A mutational event inserts an extra nucleotide pair into DNA. Which of the following outcomes do you expect? (1) No protein at all; (2) a protein in which one amino acid is changed; (3) a protein in which three amino acids are changed; (4) a protein in which two amino acids are changed; (5) a protein in which most amino acids after the site of the insertion are changed.

Short Answer

Expert verified
Most amino acids after the insertion are changed (Option 5).

Step by step solution

01

Understanding the Codon System

DNA sequences are transcribed into mRNA, and then translated into amino acids using groups of three nucleotides known as codons. Each codon specifies a particular amino acid.
02

Analyzing Codon Reading Frame

The insertion of an extra nucleotide shifts the reading frame of the mRNA sequence. This is known as a frameshift mutation, which changes how the nucleotides are grouped into codons from the point of insertion onward.
03

Consequences of Frameshift Mutations

Because the reading frame is altered, every codon after the point of insertion is affected. This change leads to entirely different amino acids being added to the chain, potentially altering protein function.
04

Evaluating Given Outcomes

Options (1) through (4) do not describe frameshift mutations satisfactorily, as they either change only one to three amino acids or predict no protein. The correct prediction for a frameshift is option (5), where most amino acids following the insertion are altered.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Codon Reading Frame
To understand frameshift mutations, we first need to grasp the concept of the codon reading frame. In the process of converting genetic information into proteins, our DNA is read in specific sequences called codons.
A codon is a sequence of three nucleotides that correspond to a specific amino acid or a stop signal during protein synthesis. This sequence dictates the order of amino acids, which ultimately determines a protein's structure and function. If we imagine the DNA as a long sentence, codons function as the individual words in that sentence.
  • Each triplet of nucleotides must be read in its correct "frame" to produce the intended protein.
  • Shifts in this reading frame can lead to different sequences being read.
Therefore, any insertion or deletion of nucleotides not in multiples of three will disturb this precise reading frame, potentially leading to significant changes in the subsequent protein structure.
Protein Synthesis
Protein synthesis is the biological mechanism where cells build proteins from genetic templates. It's a multi-step process involving two main stages: transcription and translation.
  • **Transcription**: This is the first step where the DNA is transcribed into messenger RNA (mRNA) in the nucleus.
  • **Translation**: The mRNA is transported to the ribosome, where it's read in codons to synthesize proteins.
During translation, the ribosome moves along the mRNA, reading each codon to assemble the amino acids in the correct sequence.
But when a frameshift mutation occurs, the entire reading process is altered after the mutation point. This alteration can disrupt the synthesis process, leading to the assembly of a dysfunctional protein or even a nonfunctional one. Frameshift mutations can lead to premature stop codons, halting protein synthesis prematurely and resulting in a truncated protein.
Genetic Mutation Effects
Genetic mutations can have diverse effects on protein function and thus on cell and organismal health. When a frameshift mutation occurs, the consequences are often severe due to the shift in the reading frame from the point of mutation onward.
  • **Altered Protein Structure**: The entire sequence of amino acids is changed post-insertion, offering a new set of amino acids that may lack the functional properties of the original protein.
  • **Functional Impairments**: Proteins may lose their functionality entirely or function incorrectly, potentially leading to diseases.
  • **Potential Stop Codons**: A premature stop codon might be introduced, resulting in a protein that is shorter and often nonfunctional.
Frameshift mutations are a significant type of genetic mutation because they generally result in the most drastic changes in the protein product, as observed in the presented problem where most amino acids are altered post-insertion.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

a. In how many cases in the genetic code would you fail to know the amino acid specified by a codon if you knew only the first two nucleotides of the codon? b. In how many cases would you fail to know the first two nucleotides of the codon if you knew which amino acid is specified by it?

Would you expect to find nuclear localization sequences (NLSs) in the proteins that make up prokaryotic and eukaryotic DNA and RNA polymerases? Explain why or why not.

A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the \(5^{\prime}\) and the \(3^{\prime}\) ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be? d. Assume that the original molecule is intact and that the bottom strand is transcribed from left to right. Give the RNA base sequence, and label the \(5^{\prime}\) and \(3^{\prime}\) ends of the anticodon that inserts the fourth amino acid into the nascent polypeptide. What is this amino acid?

A certain nonsense suppressor corrects a nongrowing mutant to a state that is near, but not exactly, wild type (it has abnormal growth). Suggest a possible reason why the reversion is not a full correction.

Before the true nature of the genetic coding process was fully understood, it was proposed that the message might be read in overlapping triplets. For example, the sequence GCAUC might be read as GCA CAU AUC: Devise an experimental test of this idea.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.