/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 44 A double-stranded DNA molecule w... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the \(5^{\prime}\) and the \(3^{\prime}\) ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be? d. Assume that the original molecule is intact and that the bottom strand is transcribed from left to right. Give the RNA base sequence, and label the \(5^{\prime}\) and \(3^{\prime}\) ends of the anticodon that inserts the fourth amino acid into the nascent polypeptide. What is this amino acid?

Short Answer

Expert verified
a. Bottom strand, 3' to 5'. b. Top: 5'-3', Bottom: 3'-5'. c. Likely shorter or no polypeptide. d. 5'-3' GGC, Glycine.

Step by step solution

01

Identify the Template Strand and Transcription Direction

To determine the template strand, we need to identify which strand is used by RNA polymerase to synthesize RNA. The template strand is complementary to the mRNA sequence produced. Given that transcription proceeds from the 5' to 3' direction of the mRNA, we examine the strands. Since it's stated the bottom strand is transcribed, the bottom strand is the template.
02

Label the DNA Strands

DNA is typically read 5' to 3'. The given sequence can be labeled as follows: The top strand (5'-TACATGATCATTTCACGGAATTTCTAGCATGTA-3') and the bottom strand (3'-ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT-5'), where '5' and '3' indicate the direction of the strands.
03

Determine the Effect of Inversion

An inversion between the second triplet on the left and the third on the right affects the sequence. From the left (TAC|ATG|...), and from the right (GT|ACA|...); inverting these gives TAC|GTA|ACG... and the same transcription direction is assumed. This inversion changes the sequence of codons, potentially changing the amino acids encoded. Assume the new codons translate to a stop codon reducing the length of the polypeptide.
04

Original Sequence RNA Transcription

The bottom strand transcribed gives the RNA sequence in the 5' to 3' direction: 5'-AUGUACUAGUAAAGUGCCUUA-3'. The anticodon for the fourth amino acid corresponds to the codon UGCC, hence matching anticodon GGC (5'-3'). Translate the complementary RNA strand to find the amino acid, which is Glycine (Gly) for GGC.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

DNA Template Strand
In the process of genetic transcription, the DNA template strand plays a crucial role. It is the strand that RNA polymerase uses to synthesize a complementary RNA molecule. Understanding which strand is the template is vital for predicting the RNA sequence that will be formed. When working with DNA sequences, it's important to remember the structure of DNA: it is double-stranded and each strand runs in opposite directions. These directions are marked as 5' to 3'.

In the given example, the bottom strand is identified as the template strand since transcription is stated to occur from this strand. When RNA polymerase moves along the template strand from the 3' to the 5' direction, it lays down RNA nucleotides in a 5' to 3' direction. This means it uses the bottom strand (3'-ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT-5') to create an RNA strand by adding nucleotide triphosphates complementary to the template strand. This complementary pairing is key as RNA carries the genetic message needed for protein synthesis.
RNA Base Sequence
The RNA base sequence is derived directly from the DNA template strand. During transcription, the DNA sequence is transcribed into RNA by matching the DNA bases with their RNA counterparts:
  • Adenine (A) pairs with Uracil (U) (instead of Thymine in DNA)
  • Thymine (T) pairs with Adenine (A)
  • Cytosine (C) pairs with Guanine (G)
  • Guanine (G) pairs with Cytosine (C)

This matching is critical as it ensures the RNA strand is a correct copy of the gene's information. In the example given, the RNA base sequence is obtained from the transcription of the template strand, which yields: 5'-AUGUACUAGUAAAGUGCCUUA-3'. Notice how the RNA strand aligns in the opposite direction, from 5' to 3', compared to the template DNA strand. This sequence will proceed to the ribosome where translation into proteins occurs, interpreted by triplets known as codons.
Codon Translation
Codon translation is the process through which the sequence of bases in mRNA is translated into an amino acid sequence, eventually forming a protein. The genetic code is essentially a set of instructions where each triplet of RNA bases, called a codon, corresponds to a specific amino acid. When the mRNA is read, it starts at the 5' end and moves towards the 3' end. Each codon is matched with an anticodon on the tRNA, which carries the appropriate amino acid. The tRNA pairs with the mRNA in such a way that its anticodon is complementary to the mRNA codon:
  • The codon AUG corresponds to Methionine, also known as the start codon.
  • The complementary anticodon for GUAC is CAUG, reading in 5' to 3' direction.
  • For the fourth amino acid, the codon UGCC is translated by the anticodon GGC, leading to the addition of Glycine into the peptide chain.

This systematic decoding ensures the correct assembly of amino acids. Therefore, understanding codon translation is essential for genetics and molecular biology, as it ultimately dictates protein structure and function.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

In vitro translation systems have been developed in which specific RNA molecules can be added to a test tube containing a bacterial cell extract that includes all the components needed for translation (ribosomes, tRNAs, amino acids). If a radioactively labeled amino acid is included, any protein translated from that \(\mathrm{RNA}\) can be detected and displayed on a gel. If a eukaryotic mRNA is added to the test tube, would radioactive protein be produced? Explain.

Consider the genes that specify the structure of hemoglobin. Arrange the following events in the most likely sequence in which they would take place. a. Anemia is observed. b. The shape of the oxygen-binding site is altered. c. An incorrect codon is transcribed into hemoglobin mRNA. d. The ovum (female gamete) receives a high radiation dose. e. An incorrect codon is generated in the DNA of a hemoglobin gene. f. \(A\) mother \((\text { an } X \text { -ray technician })\) accidentally steps in front of an operating X-ray generator. g. A child dies. H. the oxygen-transport capacity of the body is severely impaired. i. The tRNA anticodon that lines up is one of a type that brings an unsuitable amino acid. j. Nucleotide-pair substitution occurs in the DNA of a gene for hemoglobin.

The enzyme tryptophan synthetase is produced in two sizes, large and small. Some mutants with no enzyme activity produced exactly the same size enzymes as the wild type. Other mutants with no activity produced just the large enzyme; still others, just the small enzyme. a. Explain the different types of mutants at the level of protein structure. b. Why do you think there were no mutants that produced no enzyme?

A mutational event inserts an extra nucleotide pair into DNA. Which of the following outcomes do you expect? (1) No protein at all; (2) a protein in which one amino acid is changed; (3) a protein in which three amino acids are changed; (4) a protein in which two amino acids are changed; (5) a protein in which most amino acids after the site of the insertion are changed.

Would a chimeric translation system containing the large ribosomal subunit from \(E .\) coli and the small ribosomal subunit from yeast (a unicellular eukaryote) be able to function in protein synthesis? Explain why or why not.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.