/*! This file is auto-generated */ .wp-block-button__link{color:#fff;background-color:#32373c;border-radius:9999px;box-shadow:none;text-decoration:none;padding:calc(.667em + 2px) calc(1.333em + 2px);font-size:1.125em}.wp-block-file__button{background:#32373c;color:#fff;text-decoration:none} Problem 29 In a haploid, a nonsense suppres... [FREE SOLUTION] | 91Ó°ÊÓ

91Ó°ÊÓ

In a haploid, a nonsense suppressor \(s u 1\) acts on mutation 1 but not on mutation 2 or 3 of gene \(P\). An unlinked nonsense suppressor \(s u 2\) works on \(P\) mutation 2 but not on 1 or 3. Explain this pattern of suppression in regard to the nature of the mutations and the suppressors.

Short Answer

Expert verified
Suppressors \( su_1 \) and \( su_2 \) each recognize different stop codons, allowing specific suppression of mutations in gene \( P \).

Step by step solution

01

Understanding Nonsense Mutations

Nonsense mutations are types of mutations where a premature stop codon is introduced in the DNA sequence, leading to incomplete, and typically, nonfunctional proteins being produced. If a gene like gene \( P \) has several mutations, nonsense suppressors can potentially correct these mutations by enabling normal protein synthesis despite the early stop codon.
02

Introducing Nonsense Suppressors

Nonsense suppressors are often mutations in tRNA genes that allow specific tRNA molecules to recognize stop codons and insert an amino acid instead of terminating protein synthesis. This allows the ribosome to read through the stop codon, producing a longer, potentially functional protein.
03

Analyzing the Effect of Suppressor \( su_1 \)

The suppressor \( su_1 \) can suppress mutation 1 in gene \( P \) by allowing translation to continue through the premature stop codon introduced by mutation 1. However, \( su_1 \) cannot affect mutations 2 or 3, indicating that the nature of mutation 1 correlates specifically with the functioning mechanism of \( su_1 \).
04

Analyzing the Effect of Suppressor \( su_2 \)

Suppressor \( su_2 \) works on mutation 2 but not 1 or 3. This suggests that \( su_2 \) produces a tRNA or has a mechanism that can suppress the specific stop codon sequence found in mutation 2, different from that of mutation 1 or 3. This specificity arises because the stop codon produced by mutation 2 is one that \( su_2 \) can recognize and suppress.
05

Concluding Suppressor Specificity

The specificity of \( su_1 \) and \( su_2 \) implies different genetic mechanisms at play, perhaps due to different stop codons being produced at each mutation of gene \( P \). \( su_1 \) and \( su_2 \) each recognize different stop codons, providing suppression only where effective.

Unlock Step-by-Step Solutions & Ace Your Exams!

  • Full Textbook Solutions

    Get detailed explanations and key concepts

  • Unlimited Al creation

    Al flashcards, explanations, exams and more...

  • Ads-free access

    To over 500 millions flashcards

  • Money-back guarantee

    We refund you if you fail your exam.

Over 30 million students worldwide already upgrade their learning with 91Ó°ÊÓ!

Key Concepts

These are the key concepts you need to understand to accurately answer the question.

Nonsense mutations
Nonsense mutations occur when a DNA sequence prematurely introduces a stop codon. This results in a truncated, usually nonfunctional protein because the production process halts prematurely. These early stop signals can be detrimental because they prevent the protein from acquiring its full length and normal function.
The codons in DNA normally specify amino acids, which are building blocks of proteins. However, nonsense mutations cause these codes to unintentionally say "stop here" instead. This can significantly affect genetic instructions and the resulting organism’s traits.
Understanding nonsense mutations is crucial because they reveal how genetic information can be disrupted and how critical a full-length protein is to physiological functions.
  • Types of Stop Codons: Common stop codons are UAA, UGA, and UAG.
  • Impact: The early termination of protein synthesis can lead to diseases, including genetic disorders.
Nonsense suppressors
Nonsense suppressors are fascinating tools in genetics. They are often mutations in tRNA genes that can "fix" nonsense mutations by overriding premature stop signals. This can allow for the continuation of protein synthesis despite encountering a stop codon.
Nonsense suppressors work by providing the correct tRNA molecules that can pair with the stop codon and insert a corresponding amino acid instead. This trick bypasses the stop message and completes the protein. However, they are highly specific. A suppressor may only act on certain mutations, depending upon which stop codon is present.
  • Function: Insert amino acids in place of stop codons.
  • Specificity: Each suppressor targets specific codon sequences.

Due to their specificity, certain suppressors, like the ones discussed in gene \( P \), only act on certain mutations. For example, \( su_1 \) acts on mutation 1 because it can bypass that specific stop codon, while \( su_2 \) functions on mutation 2 similarly.
tRNA function
Transfer RNA (tRNA) plays a critical role in translating genetic information into proteins. Each tRNA molecule works by reading nucleotide sequences on mRNA and transporting the correct amino acids for protein synthesis.
One of the remarkable features of tRNA is its ability to recognize stop codons and, in cases where a nonsense suppressor mutation exists in tRNA genes, to add another amino acid instead. This unique ability forms the basis of how nonsense suppressors operate.
  • Main Role: tRNA carries amino acids to the ribosome during protein synthesis.
  • Nonsense Suppressor Activity: tRNA can be mutated to recognize stop codons, allowing the elongation of protein chains where they would usually stop.

In essence, the flexibility and specificity of tRNA molecules allow for innovative solutions to genetic issues, highlighting the sophisticated checks and functions that drive cellular life.

One App. One Place for Learning.

All the tools & learning materials you need for study success - in one app.

Get started for free

Most popular questions from this chapter

What evidence supports the view that ribosomal RNAs are a more important component of the ribosome than the ribosomal proteins?

A double-stranded DNA molecule with the sequence shown here produces, in vivo, a polypeptide that is five amino acids long. TACATGATCATTTCACGGAATTTCTAGCATGTA ATGTACTAGTAAAGTGCCTTAAAGATCGTACAT a. Which strand of DNA is the template strand, and in which direction is it transcribed? b. Label the \(5^{\prime}\) and the \(3^{\prime}\) ends of each strand. c. If an inversion occurs between the second and the third triplets from the left and right ends, respectively, and the same strand of DNA is transcribed, how long will the resultant polypeptide be? d. Assume that the original molecule is intact and that the bottom strand is transcribed from left to right. Give the RNA base sequence, and label the \(5^{\prime}\) and \(3^{\prime}\) ends of the anticodon that inserts the fourth amino acid into the nascent polypeptide. What is this amino acid?

Mutations that change a single amino acid in the active site of an enzyme can result in the synthesis of wild-type amounts of an inactive enzyme. Can you think of other regions in a protein where a single amino acid change might have the same result?

An in vitro translation system contains a eukaryotic cell extract that includes all the components needed for translation (ribosomes, tRNAs, amino acids). If bacterial RNA is added to the test tube, would a protein be produced? If not, why not?

A certain nonsense suppressor corrects a nongrowing mutant to a state that is near, but not exactly, wild type (it has abnormal growth). Suggest a possible reason why the reversion is not a full correction.

See all solutions

Recommended explanations on Biology Textbooks

View all explanations

What do you think about this solution?

We value your feedback to improve our textbook solutions.

Study anywhere. Anytime. Across all devices.